Incidental Mutation 'R6980:Dtx1'
ID 543764
Institutional Source Beutler Lab
Gene Symbol Dtx1
Ensembl Gene ENSMUSG00000029603
Gene Name deltex 1, E3 ubiquitin ligase
Synonyms Fxit1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6980 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 120680202-120711927 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120681357 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 592 (E592G)
Ref Sequence ENSEMBL: ENSMUSP00000031607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031606] [ENSMUST00000031607] [ENSMUST00000156722]
AlphaFold Q61010
Predicted Effect probably benign
Transcript: ENSMUST00000031606
SMART Domains Protein: ENSMUSP00000031606
Gene: ENSMUSG00000029602

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000031607
AA Change: E592G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031607
Gene: ENSMUSG00000029603
AA Change: E592G

DomainStartEndE-ValueType
WWE 23 102 1.29e-38 SMART
WWE 104 179 3.88e-33 SMART
low complexity region 226 251 N/A INTRINSIC
low complexity region 258 290 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RING 418 478 5.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156722
SMART Domains Protein: ENSMUSP00000123266
Gene: ENSMUSG00000029602

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Studies in Drosophila have identified this gene as encoding a positive regulator of the Notch-signaling pathway. The human gene encodes a protein of unknown function; however, it may play a role in basic helix-loop-helix transcription factor activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile with normal B and T cell devlepment and function and no gross abnormalities in any of the major organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C A 2: 25,440,866 R1189S possibly damaging Het
Abcf2 T C 5: 24,565,972 Q594R probably benign Het
Abhd18 G A 3: 40,933,780 S353N probably benign Het
Adrb1 G T 19: 56,723,614 A415S probably benign Het
Art2b T C 7: 101,580,473 N73S probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCTCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 CACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGT 3: 95,888,168 probably benign Het
Cacna1a A G 8: 84,612,285 M1753V possibly damaging Het
Cbx8 A T 11: 119,039,461 I102N possibly damaging Het
Ccdc178 T A 18: 22,105,563 E332D probably benign Het
Cfap74 G A 4: 155,466,352 probably benign Het
Chat A T 14: 32,424,154 M354K probably benign Het
Cmas A G 6: 142,756,800 T10A probably damaging Het
Cyb561d1 A T 3: 108,200,159 L51H probably benign Het
D030056L22Rik A T 19: 18,717,265 N128I probably damaging Het
D130043K22Rik G T 13: 24,864,781 A423S probably damaging Het
Dnah14 T C 1: 181,648,230 I1349T probably benign Het
Dnajb3 T G 1: 88,205,014 D222A probably damaging Het
Dzank1 C T 2: 144,490,136 G427R possibly damaging Het
E130308A19Rik A C 4: 59,719,991 K508Q probably damaging Het
Eif4e1b T A 13: 54,784,103 probably null Het
Ell2 A G 13: 75,756,376 M159V probably null Het
Eml4 G A 17: 83,451,017 V377I probably benign Het
Fryl A T 5: 73,050,430 S2466T probably benign Het
Gfpt1 C A 6: 87,077,089 T426K probably damaging Het
Gm28710 T A 5: 16,826,946 V533D possibly damaging Het
Gm49355 T C 14: 12,307,173 probably benign Het
Gm5114 T C 7: 39,409,200 I332V probably benign Het
Gpr15 T A 16: 58,718,742 probably benign Het
Gpr179 T C 11: 97,334,858 E2157G probably benign Het
Gramd4 A G 15: 86,131,969 N482S probably benign Het
Hfm1 A T 5: 106,880,477 I829K probably benign Het
Hydin A T 8: 110,413,284 E728D possibly damaging Het
Ifngr2 T A 16: 91,560,007 V143E probably damaging Het
Ift172 T C 5: 31,257,386 D1390G probably benign Het
Kdf1 A T 4: 133,528,827 D285V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mdn1 G A 4: 32,726,942 probably null Het
Megf11 A G 9: 64,705,850 E1016G probably damaging Het
Mixl1 G A 1: 180,696,888 A42V possibly damaging Het
Mpp2 A G 11: 102,059,328 W567R probably damaging Het
Mrgpra6 A G 7: 47,188,949 L136P probably damaging Het
Mroh7 T A 4: 106,700,237 I759L probably benign Het
Nrxn2 A G 19: 6,450,579 D277G probably benign Het
Nup210l A T 3: 90,119,927 K205N probably benign Het
Olfr1040 A T 2: 86,146,337 Y132* probably null Het
Olfr1284 A G 2: 111,379,275 I92V possibly damaging Het
Olfr475-ps1 A G 2: 88,623,595 *97W probably null Het
Olfr603 T C 7: 103,383,096 E302G probably benign Het
Oxnad1 C T 14: 32,085,619 probably benign Het
Pamr1 C T 2: 102,642,204 T616I probably benign Het
Pcdhgb5 C T 18: 37,733,539 H796Y possibly damaging Het
Pdlim7 G T 13: 55,508,228 D126E probably benign Het
Pfdn2 C T 1: 171,357,897 probably benign Het
Piezo2 T A 18: 63,082,961 probably null Het
Pms2 A T 5: 143,912,024 I43L probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Ptpn4 T A 1: 119,743,421 E202D possibly damaging Het
Rnf40 T A 7: 127,594,677 V455E probably damaging Het
Rp1l1 A G 14: 64,028,720 N585S probably benign Het
Rrp12 A G 19: 41,890,143 S188P probably damaging Het
Rsbn1l T A 5: 20,896,484 H686L probably benign Het
Runx2 C T 17: 44,735,316 V107I possibly damaging Het
Rusc2 A G 4: 43,422,846 I994M probably benign Het
Ryr1 T A 7: 29,109,387 D420V probably benign Het
Sash1 T C 10: 8,729,848 Q926R probably benign Het
Scgb3a2 T A 18: 43,764,434 I6N probably damaging Het
Sdc3 T A 4: 130,816,922 probably benign Het
Sik2 A G 9: 50,897,455 V658A probably benign Het
Slc25a39 A G 11: 102,405,775 V81A probably damaging Het
Snai2 T A 16: 14,708,249 S255T possibly damaging Het
Sorbs1 A T 19: 40,327,616 Y371* probably null Het
Spata31d1b A T 13: 59,715,422 H128L probably benign Het
Spdl1 A T 11: 34,830,879 M1K probably null Het
Tgm3 T A 2: 130,026,777 N211K probably benign Het
Tmem116 T C 5: 121,467,987 probably null Het
Tmem132e T A 11: 82,438,386 probably null Het
Tmem53 T C 4: 117,268,508 C251R probably damaging Het
Trcg1 A C 9: 57,245,573 D551A probably damaging Het
Trp63 T A 16: 25,802,093 F12I probably benign Het
Ttn C T 2: 76,879,057 probably null Het
Tubgcp4 T C 2: 121,195,465 V596A probably benign Het
Ugt2a3 A C 5: 87,325,632 H475Q probably damaging Het
Unc79 G A 12: 103,059,500 R382K probably damaging Het
Vmn2r58 T C 7: 41,864,238 H327R possibly damaging Het
Vmn2r7 G A 3: 64,716,566 T111I possibly damaging Het
Zfp318 T A 17: 46,397,212 Y399N probably damaging Het
Other mutations in Dtx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02733:Dtx1 APN 5 120681435 missense probably damaging 1.00
IGL03104:Dtx1 APN 5 120694965 missense possibly damaging 0.77
IGL03139:Dtx1 APN 5 120694890 missense probably damaging 0.96
R0094:Dtx1 UTSW 5 120682624 missense probably damaging 1.00
R0173:Dtx1 UTSW 5 120682753 unclassified probably benign
R0268:Dtx1 UTSW 5 120681291 missense probably damaging 1.00
R0375:Dtx1 UTSW 5 120681399 missense probably damaging 1.00
R0452:Dtx1 UTSW 5 120694992 missense possibly damaging 0.94
R1109:Dtx1 UTSW 5 120710419 start gained probably benign
R1456:Dtx1 UTSW 5 120710504 utr 5 prime probably benign
R1541:Dtx1 UTSW 5 120710346 start gained probably benign
R1554:Dtx1 UTSW 5 120683321 missense probably damaging 1.00
R2042:Dtx1 UTSW 5 120694476 missense probably benign 0.24
R2568:Dtx1 UTSW 5 120710184 missense possibly damaging 0.84
R3946:Dtx1 UTSW 5 120681286 missense possibly damaging 0.53
R4697:Dtx1 UTSW 5 120694408 critical splice donor site probably null
R6150:Dtx1 UTSW 5 120681363 missense probably damaging 1.00
R6564:Dtx1 UTSW 5 120695017 missense probably benign 0.13
R7000:Dtx1 UTSW 5 120695083 missense probably damaging 0.98
R7399:Dtx1 UTSW 5 120682393 missense possibly damaging 0.60
R9117:Dtx1 UTSW 5 120710291 missense probably benign
Z1176:Dtx1 UTSW 5 120683295 missense probably benign
Z1177:Dtx1 UTSW 5 120681351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCCCCTTAGCGCTTCTG -3'
(R):5'- GTACTAATGACAGGCTCCGAAAG -3'

Sequencing Primer
(F):5'- AGCGCTTCTGGCTCCTC -3'
(R):5'- GGAACGCAGACTCATCTT -3'
Posted On 2019-05-13