Incidental Mutation 'R6980:Gpr179'
ID543784
Institutional Source Beutler Lab
Gene Symbol Gpr179
Ensembl Gene ENSMUSG00000070337
Gene NameG protein-coupled receptor 179
Synonyms5330439C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6980 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location97332109-97352077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97334858 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2157 (E2157G)
Ref Sequence ENSEMBL: ENSMUSP00000091474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019026] [ENSMUST00000093942]
Predicted Effect probably benign
Transcript: ENSMUST00000019026
SMART Domains Protein: ENSMUSP00000019026
Gene: ENSMUSG00000018882

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Tim44 118 266 3.7e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093942
AA Change: E2157G

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091474
Gene: ENSMUSG00000070337
AA Change: E2157G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 28 41 N/A INTRINSIC
EGF 281 357 1.91e1 SMART
Pfam:7tm_3 391 633 3.2e-40 PFAM
low complexity region 735 759 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 959 988 N/A INTRINSIC
low complexity region 1107 1125 N/A INTRINSIC
internal_repeat_2 1156 1467 1.99e-12 PROSPERO
internal_repeat_1 1235 1674 2.85e-27 PROSPERO
internal_repeat_2 1569 1879 1.99e-12 PROSPERO
internal_repeat_1 1756 2284 2.85e-27 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate receptor subfamily of G protein-coupled receptors. The encoded protein has an EGF-like calcium binding domain and a seven transmembrane domain in the N-terminal region of the protein. Mutations in this gene are associated with congenital stationary night blindness type 1E. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absence of b wave without retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C A 2: 25,440,866 R1189S possibly damaging Het
Abcf2 T C 5: 24,565,972 Q594R probably benign Het
Abhd18 G A 3: 40,933,780 S353N probably benign Het
Adrb1 G T 19: 56,723,614 A415S probably benign Het
Art2b T C 7: 101,580,473 N73S probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCTCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 CACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGT 3: 95,888,168 probably benign Het
Cacna1a A G 8: 84,612,285 M1753V possibly damaging Het
Cbx8 A T 11: 119,039,461 I102N possibly damaging Het
Ccdc178 T A 18: 22,105,563 E332D probably benign Het
Cfap74 G A 4: 155,466,352 probably benign Het
Chat A T 14: 32,424,154 M354K probably benign Het
Cmas A G 6: 142,756,800 T10A probably damaging Het
Cyb561d1 A T 3: 108,200,159 L51H probably benign Het
D030056L22Rik A T 19: 18,717,265 N128I probably damaging Het
D130043K22Rik G T 13: 24,864,781 A423S probably damaging Het
Dnah14 T C 1: 181,648,230 I1349T probably benign Het
Dnajb3 T G 1: 88,205,014 D222A probably damaging Het
Dtx1 T C 5: 120,681,357 E592G probably damaging Het
Dzank1 C T 2: 144,490,136 G427R possibly damaging Het
E130308A19Rik A C 4: 59,719,991 K508Q probably damaging Het
Eif4e1b T A 13: 54,784,103 probably null Het
Ell2 A G 13: 75,756,376 M159V probably null Het
Eml4 G A 17: 83,451,017 V377I probably benign Het
Fryl A T 5: 73,050,430 S2466T probably benign Het
Gfpt1 C A 6: 87,077,089 T426K probably damaging Het
Gm28710 T A 5: 16,826,946 V533D possibly damaging Het
Gm49355 T C 14: 12,307,173 probably benign Het
Gm5114 T C 7: 39,409,200 I332V probably benign Het
Gpr15 T A 16: 58,718,742 probably benign Het
Gramd4 A G 15: 86,131,969 N482S probably benign Het
Hfm1 A T 5: 106,880,477 I829K probably benign Het
Hydin A T 8: 110,413,284 E728D possibly damaging Het
Ifngr2 T A 16: 91,560,007 V143E probably damaging Het
Ift172 T C 5: 31,257,386 D1390G probably benign Het
Kdf1 A T 4: 133,528,827 D285V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mdn1 G A 4: 32,726,942 probably null Het
Megf11 A G 9: 64,705,850 E1016G probably damaging Het
Mixl1 G A 1: 180,696,888 A42V possibly damaging Het
Mpp2 A G 11: 102,059,328 W567R probably damaging Het
Mrgpra6 A G 7: 47,188,949 L136P probably damaging Het
Mroh7 T A 4: 106,700,237 I759L probably benign Het
Nrxn2 A G 19: 6,450,579 D277G probably benign Het
Nup210l A T 3: 90,119,927 K205N probably benign Het
Olfr1040 A T 2: 86,146,337 Y132* probably null Het
Olfr1284 A G 2: 111,379,275 I92V possibly damaging Het
Olfr475-ps1 A G 2: 88,623,595 *97W probably null Het
Olfr603 T C 7: 103,383,096 E302G probably benign Het
Oxnad1 C T 14: 32,085,619 probably benign Het
Pamr1 C T 2: 102,642,204 T616I probably benign Het
Pcdhgb5 C T 18: 37,733,539 H796Y possibly damaging Het
Pdlim7 G T 13: 55,508,228 D126E probably benign Het
Pfdn2 C T 1: 171,357,897 probably benign Het
Piezo2 T A 18: 63,082,961 probably null Het
Pms2 A T 5: 143,912,024 I43L probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Ptpn4 T A 1: 119,743,421 E202D possibly damaging Het
Rnf40 T A 7: 127,594,677 V455E probably damaging Het
Rp1l1 A G 14: 64,028,720 N585S probably benign Het
Rrp12 A G 19: 41,890,143 S188P probably damaging Het
Rsbn1l T A 5: 20,896,484 H686L probably benign Het
Runx2 C T 17: 44,735,316 V107I possibly damaging Het
Rusc2 A G 4: 43,422,846 I994M probably benign Het
Ryr1 T A 7: 29,109,387 D420V probably benign Het
Sash1 T C 10: 8,729,848 Q926R probably benign Het
Scgb3a2 T A 18: 43,764,434 I6N probably damaging Het
Sdc3 T A 4: 130,816,922 probably benign Het
Sik2 A G 9: 50,897,455 V658A probably benign Het
Slc25a39 A G 11: 102,405,775 V81A probably damaging Het
Snai2 T A 16: 14,708,249 S255T possibly damaging Het
Sorbs1 A T 19: 40,327,616 Y371* probably null Het
Spata31d1b A T 13: 59,715,422 H128L probably benign Het
Spdl1 A T 11: 34,830,879 M1K probably null Het
Tgm3 T A 2: 130,026,777 N211K probably benign Het
Tmem116 T C 5: 121,467,987 probably null Het
Tmem132e T A 11: 82,438,386 probably null Het
Tmem53 T C 4: 117,268,508 C251R probably damaging Het
Trcg1 A C 9: 57,245,573 D551A probably damaging Het
Trp63 T A 16: 25,802,093 F12I probably benign Het
Ttn C T 2: 76,879,057 probably null Het
Tubgcp4 T C 2: 121,195,465 V596A probably benign Het
Ugt2a3 A C 5: 87,325,632 H475Q probably damaging Het
Unc79 G A 12: 103,059,500 R382K probably damaging Het
Vmn2r58 T C 7: 41,864,238 H327R possibly damaging Het
Vmn2r7 G A 3: 64,716,566 T111I possibly damaging Het
Zfp318 T A 17: 46,397,212 Y399N probably damaging Het
Other mutations in Gpr179
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Gpr179 APN 11 97337801 missense probably damaging 0.99
IGL01152:Gpr179 APN 11 97337411 missense probably benign 0.08
IGL01402:Gpr179 APN 11 97338186 nonsense probably null
IGL01404:Gpr179 APN 11 97338186 nonsense probably null
IGL01773:Gpr179 APN 11 97341366 missense probably benign 0.05
IGL02682:Gpr179 APN 11 97351865 missense probably benign
IGL02728:Gpr179 APN 11 97337900 missense probably damaging 0.99
IGL03243:Gpr179 APN 11 97351475 missense probably benign 0.02
IGL03272:Gpr179 APN 11 97336593 missense possibly damaging 0.89
IGL03347:Gpr179 APN 11 97351838 missense probably damaging 1.00
IGL03355:Gpr179 APN 11 97337608 missense possibly damaging 0.57
PIT4280001:Gpr179 UTSW 11 97344115 missense probably damaging 1.00
PIT4366001:Gpr179 UTSW 11 97336851 missense probably benign
R0042:Gpr179 UTSW 11 97334931 missense probably benign 0.04
R0042:Gpr179 UTSW 11 97334931 missense probably benign 0.04
R0080:Gpr179 UTSW 11 97351469 missense probably benign 0.08
R0255:Gpr179 UTSW 11 97336066 missense probably benign 0.24
R0412:Gpr179 UTSW 11 97338807 missense probably damaging 1.00
R0481:Gpr179 UTSW 11 97349718 missense probably damaging 1.00
R0612:Gpr179 UTSW 11 97338438 missense possibly damaging 0.86
R0786:Gpr179 UTSW 11 97343274 missense probably damaging 1.00
R1753:Gpr179 UTSW 11 97346578 missense probably damaging 1.00
R1761:Gpr179 UTSW 11 97335106 missense probably benign 0.00
R1796:Gpr179 UTSW 11 97336556 missense possibly damaging 0.86
R1969:Gpr179 UTSW 11 97337958 missense probably benign
R2240:Gpr179 UTSW 11 97351733 missense probably damaging 1.00
R3855:Gpr179 UTSW 11 97341434 missense probably damaging 1.00
R3913:Gpr179 UTSW 11 97334765 missense probably benign 0.01
R4484:Gpr179 UTSW 11 97335711 missense probably benign 0.28
R4806:Gpr179 UTSW 11 97349784 missense possibly damaging 0.55
R4816:Gpr179 UTSW 11 97339248 missense probably damaging 0.99
R4906:Gpr179 UTSW 11 97346661 missense possibly damaging 0.87
R4945:Gpr179 UTSW 11 97349718 missense probably damaging 1.00
R5191:Gpr179 UTSW 11 97338149 missense possibly damaging 0.76
R5273:Gpr179 UTSW 11 97347430 missense probably damaging 1.00
R5317:Gpr179 UTSW 11 97337845 missense probably damaging 1.00
R5459:Gpr179 UTSW 11 97336657 missense probably benign 0.00
R5507:Gpr179 UTSW 11 97338330 missense probably damaging 1.00
R5523:Gpr179 UTSW 11 97336782 missense probably benign 0.37
R5536:Gpr179 UTSW 11 97343815 missense probably damaging 1.00
R5591:Gpr179 UTSW 11 97345755 missense probably benign 0.17
R5679:Gpr179 UTSW 11 97336745 missense probably benign 0.20
R5738:Gpr179 UTSW 11 97351406 missense probably damaging 1.00
R5829:Gpr179 UTSW 11 97335698 missense probably benign 0.11
R5836:Gpr179 UTSW 11 97339056 missense probably benign 0.03
R6007:Gpr179 UTSW 11 97335802 nonsense probably null
R6047:Gpr179 UTSW 11 97338416 missense probably damaging 1.00
R6339:Gpr179 UTSW 11 97344176 missense probably damaging 1.00
R6383:Gpr179 UTSW 11 97337147 missense possibly damaging 0.88
R6674:Gpr179 UTSW 11 97347405 critical splice donor site probably null
R6712:Gpr179 UTSW 11 97336167 missense possibly damaging 0.94
R6835:Gpr179 UTSW 11 97347467 missense probably damaging 1.00
R7044:Gpr179 UTSW 11 97349790 missense probably benign 0.19
R7121:Gpr179 UTSW 11 97334730 missense probably benign 0.00
R7307:Gpr179 UTSW 11 97338846 missense probably benign 0.36
R7406:Gpr179 UTSW 11 97351594 missense probably damaging 0.99
R7467:Gpr179 UTSW 11 97335289 missense probably benign 0.02
R7477:Gpr179 UTSW 11 97335839 missense possibly damaging 0.87
R7725:Gpr179 UTSW 11 97351292 missense probably damaging 1.00
X0065:Gpr179 UTSW 11 97347438 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CAAAGGTTCTTGTTCTCTGACGC -3'
(R):5'- CTCTTGAAGGCAGCAGAGAC -3'

Sequencing Primer
(F):5'- GACACTCTTGCTCTCTGGGAG -3'
(R):5'- GAGACAGTCTGCCCCTTAGAAG -3'
Posted On2019-05-13