Incidental Mutation 'R6980:Zfp318'
ID543805
Institutional Source Beutler Lab
Gene Symbol Zfp318
Ensembl Gene ENSMUSG00000015597
Gene Namezinc finger protein 318
Synonyms2610034E08Rik, D530032D06Rik, TZF
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6980 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46383731-46420920 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46397212 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 399 (Y399N)
Ref Sequence ENSEMBL: ENSMUSP00000116544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113481] [ENSMUST00000138127] [ENSMUST00000152472]
Predicted Effect probably damaging
Transcript: ENSMUST00000113481
AA Change: Y399N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109109
Gene: ENSMUSG00000015597
AA Change: Y399N

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 30 127 N/A INTRINSIC
low complexity region 150 169 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
coiled coil region 348 376 N/A INTRINSIC
SCOP:d1eq1a_ 916 995 2e-4 SMART
low complexity region 1018 1055 N/A INTRINSIC
ZnF_U1 1085 1119 5.99e-7 SMART
ZnF_C2H2 1088 1112 4.5e1 SMART
ZnF_U1 1155 1189 2.1e-11 SMART
ZnF_C2H2 1158 1180 4.62e1 SMART
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1358 1371 N/A INTRINSIC
low complexity region 1640 1651 N/A INTRINSIC
Blast:HNHc 1660 1710 3e-17 BLAST
low complexity region 2001 2013 N/A INTRINSIC
low complexity region 2110 2121 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138127
AA Change: Y399N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116544
Gene: ENSMUSG00000015597
AA Change: Y399N

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 30 127 N/A INTRINSIC
low complexity region 150 169 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
coiled coil region 348 376 N/A INTRINSIC
Blast:HOLI 854 1114 8e-19 BLAST
SCOP:d1eq1a_ 916 995 6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152472
SMART Domains Protein: ENSMUSP00000116132
Gene: ENSMUSG00000015597

DomainStartEndE-ValueType
coiled coil region 3 30 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced male fertility and altered IgM and IgD levels. Null mutants displayed normal level of circulating B cells with decreased IgD and increased IgM levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C A 2: 25,440,866 R1189S possibly damaging Het
Abcf2 T C 5: 24,565,972 Q594R probably benign Het
Abhd18 G A 3: 40,933,780 S353N probably benign Het
Adrb1 G T 19: 56,723,614 A415S probably benign Het
Art2b T C 7: 101,580,473 N73S probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCTCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 CACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGT 3: 95,888,168 probably benign Het
Cacna1a A G 8: 84,612,285 M1753V possibly damaging Het
Cbx8 A T 11: 119,039,461 I102N possibly damaging Het
Ccdc178 T A 18: 22,105,563 E332D probably benign Het
Cfap74 G A 4: 155,466,352 probably benign Het
Chat A T 14: 32,424,154 M354K probably benign Het
Cmas A G 6: 142,756,800 T10A probably damaging Het
Cyb561d1 A T 3: 108,200,159 L51H probably benign Het
D030056L22Rik A T 19: 18,717,265 N128I probably damaging Het
D130043K22Rik G T 13: 24,864,781 A423S probably damaging Het
Dnah14 T C 1: 181,648,230 I1349T probably benign Het
Dnajb3 T G 1: 88,205,014 D222A probably damaging Het
Dtx1 T C 5: 120,681,357 E592G probably damaging Het
Dzank1 C T 2: 144,490,136 G427R possibly damaging Het
E130308A19Rik A C 4: 59,719,991 K508Q probably damaging Het
Eif4e1b T A 13: 54,784,103 probably null Het
Ell2 A G 13: 75,756,376 M159V probably null Het
Eml4 G A 17: 83,451,017 V377I probably benign Het
Fryl A T 5: 73,050,430 S2466T probably benign Het
Gfpt1 C A 6: 87,077,089 T426K probably damaging Het
Gm28710 T A 5: 16,826,946 V533D possibly damaging Het
Gm49355 T C 14: 12,307,173 probably benign Het
Gm5114 T C 7: 39,409,200 I332V probably benign Het
Gpr15 T A 16: 58,718,742 probably benign Het
Gpr179 T C 11: 97,334,858 E2157G probably benign Het
Gramd4 A G 15: 86,131,969 N482S probably benign Het
Hfm1 A T 5: 106,880,477 I829K probably benign Het
Hydin A T 8: 110,413,284 E728D possibly damaging Het
Ifngr2 T A 16: 91,560,007 V143E probably damaging Het
Ift172 T C 5: 31,257,386 D1390G probably benign Het
Kdf1 A T 4: 133,528,827 D285V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mdn1 G A 4: 32,726,942 probably null Het
Megf11 A G 9: 64,705,850 E1016G probably damaging Het
Mixl1 G A 1: 180,696,888 A42V possibly damaging Het
Mpp2 A G 11: 102,059,328 W567R probably damaging Het
Mrgpra6 A G 7: 47,188,949 L136P probably damaging Het
Mroh7 T A 4: 106,700,237 I759L probably benign Het
Nrxn2 A G 19: 6,450,579 D277G probably benign Het
Nup210l A T 3: 90,119,927 K205N probably benign Het
Olfr1040 A T 2: 86,146,337 Y132* probably null Het
Olfr1284 A G 2: 111,379,275 I92V possibly damaging Het
Olfr475-ps1 A G 2: 88,623,595 *97W probably null Het
Olfr603 T C 7: 103,383,096 E302G probably benign Het
Oxnad1 C T 14: 32,085,619 probably benign Het
Pamr1 C T 2: 102,642,204 T616I probably benign Het
Pcdhgb5 C T 18: 37,733,539 H796Y possibly damaging Het
Pdlim7 G T 13: 55,508,228 D126E probably benign Het
Pfdn2 C T 1: 171,357,897 probably benign Het
Piezo2 T A 18: 63,082,961 probably null Het
Pms2 A T 5: 143,912,024 I43L probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Ptpn4 T A 1: 119,743,421 E202D possibly damaging Het
Rnf40 T A 7: 127,594,677 V455E probably damaging Het
Rp1l1 A G 14: 64,028,720 N585S probably benign Het
Rrp12 A G 19: 41,890,143 S188P probably damaging Het
Rsbn1l T A 5: 20,896,484 H686L probably benign Het
Runx2 C T 17: 44,735,316 V107I possibly damaging Het
Rusc2 A G 4: 43,422,846 I994M probably benign Het
Ryr1 T A 7: 29,109,387 D420V probably benign Het
Sash1 T C 10: 8,729,848 Q926R probably benign Het
Scgb3a2 T A 18: 43,764,434 I6N probably damaging Het
Sdc3 T A 4: 130,816,922 probably benign Het
Sik2 A G 9: 50,897,455 V658A probably benign Het
Slc25a39 A G 11: 102,405,775 V81A probably damaging Het
Snai2 T A 16: 14,708,249 S255T possibly damaging Het
Sorbs1 A T 19: 40,327,616 Y371* probably null Het
Spata31d1b A T 13: 59,715,422 H128L probably benign Het
Spdl1 A T 11: 34,830,879 M1K probably null Het
Tgm3 T A 2: 130,026,777 N211K probably benign Het
Tmem116 T C 5: 121,467,987 probably null Het
Tmem132e T A 11: 82,438,386 probably null Het
Tmem53 T C 4: 117,268,508 C251R probably damaging Het
Trcg1 A C 9: 57,245,573 D551A probably damaging Het
Trp63 T A 16: 25,802,093 F12I probably benign Het
Ttn C T 2: 76,879,057 probably null Het
Tubgcp4 T C 2: 121,195,465 V596A probably benign Het
Ugt2a3 A C 5: 87,325,632 H475Q probably damaging Het
Unc79 G A 12: 103,059,500 R382K probably damaging Het
Vmn2r58 T C 7: 41,864,238 H327R possibly damaging Het
Vmn2r7 G A 3: 64,716,566 T111I possibly damaging Het
Other mutations in Zfp318
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Zfp318 APN 17 46412472 missense probably benign 0.01
IGL00978:Zfp318 APN 17 46413726 missense possibly damaging 0.64
IGL01016:Zfp318 APN 17 46400077 missense probably damaging 1.00
IGL01310:Zfp318 APN 17 46413227 missense possibly damaging 0.81
IGL01453:Zfp318 APN 17 46409016 splice site probably null
IGL01887:Zfp318 APN 17 46399168 missense probably benign 0.07
IGL02025:Zfp318 APN 17 46396810 nonsense probably null
IGL02026:Zfp318 APN 17 46396810 nonsense probably null
IGL02070:Zfp318 APN 17 46396718 missense probably damaging 1.00
IGL02182:Zfp318 APN 17 46396810 nonsense probably null
IGL02187:Zfp318 APN 17 46396810 nonsense probably null
IGL02188:Zfp318 APN 17 46396810 nonsense probably null
IGL02189:Zfp318 APN 17 46396810 nonsense probably null
IGL02190:Zfp318 APN 17 46396810 nonsense probably null
IGL02191:Zfp318 APN 17 46396810 nonsense probably null
IGL02192:Zfp318 APN 17 46396810 nonsense probably null
IGL02203:Zfp318 APN 17 46396810 nonsense probably null
IGL02224:Zfp318 APN 17 46396810 nonsense probably null
IGL02230:Zfp318 APN 17 46396810 nonsense probably null
IGL02231:Zfp318 APN 17 46396810 nonsense probably null
IGL02232:Zfp318 APN 17 46396810 nonsense probably null
IGL02233:Zfp318 APN 17 46396810 nonsense probably null
IGL02234:Zfp318 APN 17 46396810 nonsense probably null
IGL02412:Zfp318 APN 17 46409117 nonsense probably null
IGL02792:Zfp318 APN 17 46409178 missense probably damaging 1.00
IGL02826:Zfp318 APN 17 46398754 missense probably damaging 1.00
Wonton UTSW 17 46409692 missense possibly damaging 0.89
I0000:Zfp318 UTSW 17 46399559 missense probably damaging 1.00
R0206:Zfp318 UTSW 17 46399019 missense probably benign 0.07
R0240:Zfp318 UTSW 17 46396813 missense probably benign 0.00
R0240:Zfp318 UTSW 17 46396813 missense probably benign 0.00
R0281:Zfp318 UTSW 17 46412614 missense probably benign 0.05
R0350:Zfp318 UTSW 17 46413198 missense probably benign 0.00
R0383:Zfp318 UTSW 17 46413296 missense probably damaging 0.99
R0453:Zfp318 UTSW 17 46396708 missense probably damaging 0.96
R1014:Zfp318 UTSW 17 46412536 nonsense probably null
R1166:Zfp318 UTSW 17 46409692 missense possibly damaging 0.89
R1208:Zfp318 UTSW 17 46412520 unclassified probably benign
R1208:Zfp318 UTSW 17 46412520 unclassified probably benign
R1327:Zfp318 UTSW 17 46413263 missense probably damaging 1.00
R1330:Zfp318 UTSW 17 46413758 missense possibly damaging 0.90
R1737:Zfp318 UTSW 17 46399477 missense probably benign 0.35
R1800:Zfp318 UTSW 17 46412054 missense probably benign 0.00
R1846:Zfp318 UTSW 17 46413666 missense probably benign 0.00
R1848:Zfp318 UTSW 17 46406055 missense possibly damaging 0.92
R1861:Zfp318 UTSW 17 46411440 missense possibly damaging 0.92
R1913:Zfp318 UTSW 17 46412524 unclassified probably benign
R1913:Zfp318 UTSW 17 46412514 unclassified probably benign
R2059:Zfp318 UTSW 17 46397024 missense probably damaging 0.99
R2085:Zfp318 UTSW 17 46409664 intron probably null
R2122:Zfp318 UTSW 17 46413371 missense probably benign 0.01
R2339:Zfp318 UTSW 17 46399463 missense probably benign 0.01
R4526:Zfp318 UTSW 17 46412358 missense probably benign 0.00
R4564:Zfp318 UTSW 17 46412815 missense possibly damaging 0.77
R4689:Zfp318 UTSW 17 46399634 missense probably damaging 0.99
R4795:Zfp318 UTSW 17 46412062 missense probably benign 0.07
R5256:Zfp318 UTSW 17 46412069 missense probably benign 0.19
R5317:Zfp318 UTSW 17 46412537 unclassified probably benign
R5323:Zfp318 UTSW 17 46386736 missense probably damaging 0.99
R5436:Zfp318 UTSW 17 46413049 missense possibly damaging 0.95
R5485:Zfp318 UTSW 17 46412254 missense possibly damaging 0.81
R5627:Zfp318 UTSW 17 46413136 missense probably damaging 1.00
R5643:Zfp318 UTSW 17 46409244 intron probably benign
R5782:Zfp318 UTSW 17 46412514 unclassified probably benign
R5783:Zfp318 UTSW 17 46412514 unclassified probably benign
R5820:Zfp318 UTSW 17 46412773 missense probably benign
R5895:Zfp318 UTSW 17 46399033 missense probably damaging 1.00
R6189:Zfp318 UTSW 17 46412514 unclassified probably benign
R6385:Zfp318 UTSW 17 46411006 missense probably damaging 1.00
R6428:Zfp318 UTSW 17 46399336 missense probably damaging 1.00
R6471:Zfp318 UTSW 17 46399505 missense probably benign 0.05
R6666:Zfp318 UTSW 17 46409214 missense probably benign 0.01
R6812:Zfp318 UTSW 17 46412542 unclassified probably benign
R6852:Zfp318 UTSW 17 46412533 unclassified probably benign
R6852:Zfp318 UTSW 17 46412534 unclassified probably benign
R6852:Zfp318 UTSW 17 46412538 unclassified probably benign
R6854:Zfp318 UTSW 17 46412542 unclassified probably benign
R6999:Zfp318 UTSW 17 46400043 missense probably damaging 1.00
R7164:Zfp318 UTSW 17 46397306 critical splice donor site probably null
R7164:Zfp318 UTSW 17 46405939 missense probably damaging 1.00
R7175:Zfp318 UTSW 17 46386848 missense probably damaging 1.00
R7233:Zfp318 UTSW 17 46406052 missense probably damaging 0.99
R7339:Zfp318 UTSW 17 46411247 missense probably damaging 0.99
R7426:Zfp318 UTSW 17 46400069 missense probably damaging 1.00
R7600:Zfp318 UTSW 17 46384284 missense possibly damaging 0.86
R7608:Zfp318 UTSW 17 46400009 missense probably damaging 0.96
R7779:Zfp318 UTSW 17 46399894 missense probably benign 0.16
X0026:Zfp318 UTSW 17 46410638 missense possibly damaging 0.89
X0054:Zfp318 UTSW 17 46412609 missense possibly damaging 0.79
X0065:Zfp318 UTSW 17 46410989 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCCTAGGTTTCTAGATCCC -3'
(R):5'- AACAGAAGCCCTTGTTGATACG -3'

Sequencing Primer
(F):5'- TCTAGATCCCGAGTTTCGAGAAC -3'
(R):5'- CAGAAGCCCTTGTTGATACGCTATG -3'
Posted On2019-05-13