Incidental Mutation 'R6980:Sorbs1'
ID543813
Institutional Source Beutler Lab
Gene Symbol Sorbs1
Ensembl Gene ENSMUSG00000025006
Gene Namesorbin and SH3 domain containing 1
Synonyms9530001P15Rik, 2310065E01Rik, Ponsin, Sh3d5, CAP, c-Cbl-associated protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.839) question?
Stock #R6980 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location40294753-40513779 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 40327616 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 371 (Y371*)
Ref Sequence ENSEMBL: ENSMUSP00000153489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099466] [ENSMUST00000099467] [ENSMUST00000165212] [ENSMUST00000165469] [ENSMUST00000224247] [ENSMUST00000224667] [ENSMUST00000225148] [ENSMUST00000225153] [ENSMUST00000225786] [ENSMUST00000226047]
Predicted Effect probably null
Transcript: ENSMUST00000099466
AA Change: Y360*
SMART Domains Protein: ENSMUSP00000097065
Gene: ENSMUSG00000025006
AA Change: Y360*

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 203 249 1.07e-26 SMART
SH3 502 557 2.72e-18 SMART
SH3 576 633 9.32e-17 SMART
low complexity region 647 660 N/A INTRINSIC
SH3 682 739 3.7e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099467
AA Change: Y614*
SMART Domains Protein: ENSMUSP00000097066
Gene: ENSMUSG00000025006
AA Change: Y614*

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 192 213 N/A INTRINSIC
Sorb 327 373 1.24e-22 SMART
coiled coil region 558 584 N/A INTRINSIC
SH3 700 755 2.72e-18 SMART
SH3 774 831 9.32e-17 SMART
low complexity region 845 858 N/A INTRINSIC
SH3 880 937 3.7e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165212
AA Change: Y400*
SMART Domains Protein: ENSMUSP00000126460
Gene: ENSMUSG00000025006
AA Change: Y400*

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Sorb 193 239 1.07e-26 SMART
SH3 486 541 2.72e-18 SMART
SH3 560 617 9.32e-17 SMART
low complexity region 631 644 N/A INTRINSIC
SH3 666 723 3.7e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165469
AA Change: Y390*
SMART Domains Protein: ENSMUSP00000125768
Gene: ENSMUSG00000025006
AA Change: Y390*

DomainStartEndE-ValueType
low complexity region 75 93 N/A INTRINSIC
Sorb 233 279 1.07e-26 SMART
SH3 476 531 2.72e-18 SMART
SH3 550 607 9.32e-17 SMART
low complexity region 621 634 N/A INTRINSIC
SH3 656 713 3.7e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000224247
AA Change: Y360*
Predicted Effect probably null
Transcript: ENSMUST00000224667
AA Change: Y421*
Predicted Effect probably null
Transcript: ENSMUST00000225148
AA Change: Y360*
Predicted Effect probably null
Transcript: ENSMUST00000225153
AA Change: Y614*
Predicted Effect probably null
Transcript: ENSMUST00000225786
AA Change: Y390*
Predicted Effect probably null
Transcript: ENSMUST00000226047
AA Change: Y371*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased triglyceride levels, altered glucose homeostasis, decreased white blood cells and resistance to developing glucose intolerance induced by a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C A 2: 25,440,866 R1189S possibly damaging Het
Abcf2 T C 5: 24,565,972 Q594R probably benign Het
Abhd18 G A 3: 40,933,780 S353N probably benign Het
Adrb1 G T 19: 56,723,614 A415S probably benign Het
Art2b T C 7: 101,580,473 N73S probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCTCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 CACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGT 3: 95,888,168 probably benign Het
Cacna1a A G 8: 84,612,285 M1753V possibly damaging Het
Cbx8 A T 11: 119,039,461 I102N possibly damaging Het
Ccdc178 T A 18: 22,105,563 E332D probably benign Het
Cfap74 G A 4: 155,466,352 probably benign Het
Chat A T 14: 32,424,154 M354K probably benign Het
Cmas A G 6: 142,756,800 T10A probably damaging Het
Cyb561d1 A T 3: 108,200,159 L51H probably benign Het
D030056L22Rik A T 19: 18,717,265 N128I probably damaging Het
D130043K22Rik G T 13: 24,864,781 A423S probably damaging Het
Dnah14 T C 1: 181,648,230 I1349T probably benign Het
Dnajb3 T G 1: 88,205,014 D222A probably damaging Het
Dtx1 T C 5: 120,681,357 E592G probably damaging Het
Dzank1 C T 2: 144,490,136 G427R possibly damaging Het
E130308A19Rik A C 4: 59,719,991 K508Q probably damaging Het
Eif4e1b T A 13: 54,784,103 probably null Het
Ell2 A G 13: 75,756,376 M159V probably null Het
Eml4 G A 17: 83,451,017 V377I probably benign Het
Fryl A T 5: 73,050,430 S2466T probably benign Het
Gfpt1 C A 6: 87,077,089 T426K probably damaging Het
Gm28710 T A 5: 16,826,946 V533D possibly damaging Het
Gm49355 T C 14: 12,307,173 probably benign Het
Gm5114 T C 7: 39,409,200 I332V probably benign Het
Gpr15 T A 16: 58,718,742 probably benign Het
Gpr179 T C 11: 97,334,858 E2157G probably benign Het
Gramd4 A G 15: 86,131,969 N482S probably benign Het
Hfm1 A T 5: 106,880,477 I829K probably benign Het
Hydin A T 8: 110,413,284 E728D possibly damaging Het
Ifngr2 T A 16: 91,560,007 V143E probably damaging Het
Ift172 T C 5: 31,257,386 D1390G probably benign Het
Kdf1 A T 4: 133,528,827 D285V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mdn1 G A 4: 32,726,942 probably null Het
Megf11 A G 9: 64,705,850 E1016G probably damaging Het
Mixl1 G A 1: 180,696,888 A42V possibly damaging Het
Mpp2 A G 11: 102,059,328 W567R probably damaging Het
Mrgpra6 A G 7: 47,188,949 L136P probably damaging Het
Mroh7 T A 4: 106,700,237 I759L probably benign Het
Nrxn2 A G 19: 6,450,579 D277G probably benign Het
Nup210l A T 3: 90,119,927 K205N probably benign Het
Olfr1040 A T 2: 86,146,337 Y132* probably null Het
Olfr1284 A G 2: 111,379,275 I92V possibly damaging Het
Olfr475-ps1 A G 2: 88,623,595 *97W probably null Het
Olfr603 T C 7: 103,383,096 E302G probably benign Het
Oxnad1 C T 14: 32,085,619 probably benign Het
Pamr1 C T 2: 102,642,204 T616I probably benign Het
Pcdhgb5 C T 18: 37,733,539 H796Y possibly damaging Het
Pdlim7 G T 13: 55,508,228 D126E probably benign Het
Pfdn2 C T 1: 171,357,897 probably benign Het
Piezo2 T A 18: 63,082,961 probably null Het
Pms2 A T 5: 143,912,024 I43L probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Ptpn4 T A 1: 119,743,421 E202D possibly damaging Het
Rnf40 T A 7: 127,594,677 V455E probably damaging Het
Rp1l1 A G 14: 64,028,720 N585S probably benign Het
Rrp12 A G 19: 41,890,143 S188P probably damaging Het
Rsbn1l T A 5: 20,896,484 H686L probably benign Het
Runx2 C T 17: 44,735,316 V107I possibly damaging Het
Rusc2 A G 4: 43,422,846 I994M probably benign Het
Ryr1 T A 7: 29,109,387 D420V probably benign Het
Sash1 T C 10: 8,729,848 Q926R probably benign Het
Scgb3a2 T A 18: 43,764,434 I6N probably damaging Het
Sdc3 T A 4: 130,816,922 probably benign Het
Sik2 A G 9: 50,897,455 V658A probably benign Het
Slc25a39 A G 11: 102,405,775 V81A probably damaging Het
Snai2 T A 16: 14,708,249 S255T possibly damaging Het
Spata31d1b A T 13: 59,715,422 H128L probably benign Het
Spdl1 A T 11: 34,830,879 M1K probably null Het
Tgm3 T A 2: 130,026,777 N211K probably benign Het
Tmem116 T C 5: 121,467,987 probably null Het
Tmem132e T A 11: 82,438,386 probably null Het
Tmem53 T C 4: 117,268,508 C251R probably damaging Het
Trcg1 A C 9: 57,245,573 D551A probably damaging Het
Trp63 T A 16: 25,802,093 F12I probably benign Het
Ttn C T 2: 76,879,057 probably null Het
Tubgcp4 T C 2: 121,195,465 V596A probably benign Het
Ugt2a3 A C 5: 87,325,632 H475Q probably damaging Het
Unc79 G A 12: 103,059,500 R382K probably damaging Het
Vmn2r58 T C 7: 41,864,238 H327R possibly damaging Het
Vmn2r7 G A 3: 64,716,566 T111I possibly damaging Het
Zfp318 T A 17: 46,397,212 Y399N probably damaging Het
Other mutations in Sorbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Sorbs1 APN 19 40318029 missense probably damaging 1.00
IGL00776:Sorbs1 APN 19 40344351 splice site probably null
IGL00788:Sorbs1 APN 19 40337043 splice site probably benign
IGL00943:Sorbs1 APN 19 40295040 utr 3 prime probably benign
IGL01525:Sorbs1 APN 19 40349978 missense probably damaging 1.00
IGL01530:Sorbs1 APN 19 40376647 missense probably benign 0.01
IGL01951:Sorbs1 APN 19 40318016 splice site probably benign
IGL02159:Sorbs1 APN 19 40327596 missense probably damaging 0.96
IGL02252:Sorbs1 APN 19 40314397 missense probably damaging 1.00
IGL02613:Sorbs1 APN 19 40327547 missense probably damaging 1.00
IGL02643:Sorbs1 APN 19 40365133 missense possibly damaging 0.65
IGL02668:Sorbs1 APN 19 40314681 missense probably damaging 1.00
IGL02738:Sorbs1 APN 19 40376904 missense probably damaging 0.97
IGL02965:Sorbs1 APN 19 40376743 missense probably benign 0.01
IGL03083:Sorbs1 APN 19 40314376 missense probably damaging 1.00
IGL03173:Sorbs1 APN 19 40363262 missense probably damaging 1.00
IGL03286:Sorbs1 APN 19 40344414 missense probably damaging 0.99
IGL03292:Sorbs1 APN 19 40373565 missense possibly damaging 0.79
R0016:Sorbs1 UTSW 19 40314738 splice site probably benign
R0016:Sorbs1 UTSW 19 40314738 splice site probably benign
R0306:Sorbs1 UTSW 19 40344411 missense possibly damaging 0.94
R0526:Sorbs1 UTSW 19 40349948 missense probably damaging 1.00
R0551:Sorbs1 UTSW 19 40311816 missense probably damaging 1.00
R0688:Sorbs1 UTSW 19 40363262 missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40382606 missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40382606 missense probably damaging 1.00
R1185:Sorbs1 UTSW 19 40382606 missense probably damaging 1.00
R1891:Sorbs1 UTSW 19 40393460 missense probably damaging 0.99
R2066:Sorbs1 UTSW 19 40365028 unclassified probably null
R2148:Sorbs1 UTSW 19 40376824 missense possibly damaging 0.94
R2214:Sorbs1 UTSW 19 40296631 missense probably damaging 1.00
R2410:Sorbs1 UTSW 19 40373515 missense probably damaging 0.99
R2940:Sorbs1 UTSW 19 40373571 missense probably damaging 1.00
R3847:Sorbs1 UTSW 19 40314443 missense probably damaging 0.97
R4405:Sorbs1 UTSW 19 40395745 missense probably benign 0.03
R4544:Sorbs1 UTSW 19 40311850 missense probably damaging 0.99
R4618:Sorbs1 UTSW 19 40373518 missense probably damaging 0.99
R4731:Sorbs1 UTSW 19 40314689 missense probably benign 0.29
R4732:Sorbs1 UTSW 19 40314689 missense probably benign 0.29
R4733:Sorbs1 UTSW 19 40314689 missense probably benign 0.29
R4860:Sorbs1 UTSW 19 40337005 missense probably benign 0.44
R4860:Sorbs1 UTSW 19 40337005 missense probably benign 0.44
R4907:Sorbs1 UTSW 19 40340047 nonsense probably null
R4912:Sorbs1 UTSW 19 40311727 missense probably damaging 1.00
R5229:Sorbs1 UTSW 19 40340707 missense probably damaging 1.00
R5285:Sorbs1 UTSW 19 40321890 missense probably damaging 1.00
R5416:Sorbs1 UTSW 19 40376989 missense probably benign 0.06
R5706:Sorbs1 UTSW 19 40376881 missense probably benign
R5871:Sorbs1 UTSW 19 40398583 missense probably damaging 1.00
R5936:Sorbs1 UTSW 19 40324772 missense probably damaging 0.96
R6073:Sorbs1 UTSW 19 40314657 missense probably damaging 1.00
R6324:Sorbs1 UTSW 19 40321819 missense probably damaging 0.99
R6343:Sorbs1 UTSW 19 40376982 critical splice donor site probably null
R6561:Sorbs1 UTSW 19 40326052 missense probably benign
R6646:Sorbs1 UTSW 19 40325549 missense probably damaging 1.00
R6768:Sorbs1 UTSW 19 40327547 missense probably damaging 1.00
R6849:Sorbs1 UTSW 19 40376800 missense probably benign
R6850:Sorbs1 UTSW 19 40376800 missense probably benign
R6878:Sorbs1 UTSW 19 40376800 missense probably benign
R6879:Sorbs1 UTSW 19 40376800 missense probably benign
R6880:Sorbs1 UTSW 19 40376800 missense probably benign
R6908:Sorbs1 UTSW 19 40352332 missense probably damaging 1.00
R7040:Sorbs1 UTSW 19 40376800 missense probably benign
R7041:Sorbs1 UTSW 19 40376800 missense probably benign
R7110:Sorbs1 UTSW 19 40376800 missense probably benign
R7122:Sorbs1 UTSW 19 40376800 missense probably benign
R7170:Sorbs1 UTSW 19 40326129 nonsense probably null
R7180:Sorbs1 UTSW 19 40376800 missense probably benign
R7185:Sorbs1 UTSW 19 40376800 missense probably benign
R7187:Sorbs1 UTSW 19 40376800 missense probably benign
R7254:Sorbs1 UTSW 19 40376800 missense probably benign
R7255:Sorbs1 UTSW 19 40376800 missense probably benign
R7401:Sorbs1 UTSW 19 40376800 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTACCTTTAGTGGAAGCTGAGC -3'
(R):5'- TGCCTGTCCGCAGAAATCTG -3'

Sequencing Primer
(F):5'- AGCTGGAAGGTCGCTTGAGC -3'
(R):5'- GGTCTTACATGGCCCCTTATGAAAG -3'
Posted On2019-05-13