Incidental Mutation 'R6991:Olfr1000'
ID543822
Institutional Source Beutler Lab
Gene Symbol Olfr1000
Ensembl Gene ENSMUSG00000075215
Gene Nameolfactory receptor 1000
SynonymsMOR175-9, GA_x6K02T2Q125-47087719-47086775
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6991 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85607037-85611903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85608248 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 221 (I221V)
Ref Sequence ENSEMBL: ENSMUSP00000150731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099921] [ENSMUST00000213837] [ENSMUST00000216571]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099921
AA Change: I221V

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097505
Gene: ENSMUSG00000075215
AA Change: I221V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.1e-49 PFAM
Pfam:7tm_1 41 290 2.9e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213837
AA Change: I221V

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216571
AA Change: I221V

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,580,446 V278D probably damaging Het
2410089E03Rik A G 15: 8,252,206 E2843G unknown Het
9930021J03Rik A G 19: 29,719,108 L995S possibly damaging Het
Akap12 G T 10: 4,357,122 E1311* probably null Het
Ankdd1a T A 9: 65,508,675 D186V probably benign Het
Birc6 A G 17: 74,562,095 E346G probably damaging Het
Ccr7 A C 11: 99,145,304 V264G probably damaging Het
Col7a1 T C 9: 108,983,919 probably null Het
Coq8a T C 1: 180,179,068 T132A probably benign Het
Cyp2b10 G A 7: 25,917,355 S407N probably benign Het
Ddi2 A G 4: 141,685,250 V117A probably benign Het
Ddx42 G A 11: 106,239,144 V421I probably damaging Het
Dip2c T A 13: 9,551,860 L285* probably null Het
Dip2c C T 13: 9,634,832 S1232F probably damaging Het
Dner T A 1: 84,476,402 R402* probably null Het
Dpysl3 A T 18: 43,353,891 I317N probably damaging Het
Dusp23 T A 1: 172,631,657 Y146F probably benign Het
Eef1a2 C A 2: 181,148,628 V412L possibly damaging Het
Epha7 C T 4: 28,821,489 T218I probably damaging Het
Gigyf2 T A 1: 87,407,136 C284S probably damaging Het
Gm16427 T A 5: 93,484,374 N107I probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hao2 T A 3: 98,876,752 E327V probably damaging Het
Hdhd5 A G 6: 120,510,169 V409A probably damaging Het
Kif9 T C 9: 110,494,622 Y236H probably damaging Het
Kri1 T C 9: 21,287,754 probably benign Het
Lig4 A T 8: 9,971,098 V894E probably damaging Het
Lrriq1 T C 10: 103,187,458 N982S probably damaging Het
Mapk8 T C 14: 33,410,884 I32V possibly damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mstn T C 1: 53,061,941 I59T probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Npw A C 17: 24,658,055 V124G probably benign Het
Nxph3 A G 11: 95,511,418 S57P probably damaging Het
Olfr1145 G A 2: 87,810,443 D208N possibly damaging Het
Olfr1443 G T 19: 12,680,748 L213F probably benign Het
Olfr493 T A 7: 108,346,088 N298Y possibly damaging Het
Olfr677 T C 7: 105,056,564 I106T probably damaging Het
Opn4 A T 14: 34,593,907 L390M probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2g2e G A 4: 138,880,675 C62Y probably damaging Het
Plcb4 G A 2: 135,910,194 V107M probably damaging Het
Prorsd1 A C 11: 29,514,486 probably benign Het
Prox2 A G 12: 85,087,391 L587P probably benign Het
Prr22 A G 17: 56,771,345 D166G possibly damaging Het
Ptprz1 G A 6: 23,002,687 R1592Q probably benign Het
Rarg C G 15: 102,241,915 R74P probably damaging Het
Rcan1 A G 16: 92,397,363 V54A probably benign Het
Rmdn2 A G 17: 79,621,310 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Serpina1a T C 12: 103,853,833 T385A probably benign Het
Slc44a3 T C 3: 121,532,165 Y12C probably benign Het
Smg1 C A 7: 118,167,868 probably benign Het
Spock3 A G 8: 63,355,381 *437W probably null Het
Sugct T A 13: 17,554,380 Q220H probably benign Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Tnks C A 8: 34,834,493 R1274I probably damaging Het
Trp53bp1 C T 2: 121,208,040 R1439H probably damaging Het
Vmn1r16 G T 6: 57,322,884 S251* probably null Het
Vmn2r15 T A 5: 109,293,314 Q226L probably damaging Het
Vmn2r67 T G 7: 85,155,745 Y53S possibly damaging Het
Vmn2r99 A G 17: 19,378,110 N132S probably benign Het
Wdr73 T G 7: 80,891,856 T313P probably benign Het
Zfp65 C T 13: 67,708,521 R213Q probably damaging Het
Other mutations in Olfr1000
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Olfr1000 APN 2 85608761 missense probably benign
IGL01872:Olfr1000 APN 2 85608329 missense probably benign
IGL01955:Olfr1000 APN 2 85608707 missense probably benign 0.12
IGL02132:Olfr1000 APN 2 85608320 missense probably benign 0.00
IGL02139:Olfr1000 APN 2 85608230 nonsense probably null
IGL02717:Olfr1000 APN 2 85608772 missense probably damaging 1.00
IGL02950:Olfr1000 APN 2 85608157 missense possibly damaging 0.92
R1866:Olfr1000 UTSW 2 85608844 missense probably benign 0.05
R1868:Olfr1000 UTSW 2 85608065 missense probably damaging 0.98
R1869:Olfr1000 UTSW 2 85608500 missense probably benign 0.23
R2256:Olfr1000 UTSW 2 85608463 missense possibly damaging 0.81
R2919:Olfr1000 UTSW 2 85608410 missense probably benign 0.06
R4736:Olfr1000 UTSW 2 85607983 missense probably benign
R5197:Olfr1000 UTSW 2 85608447 missense probably benign 0.01
R5256:Olfr1000 UTSW 2 85608473 missense probably benign
R5367:Olfr1000 UTSW 2 85608374 missense probably damaging 0.99
R5389:Olfr1000 UTSW 2 85608283 missense probably benign
R7017:Olfr1000 UTSW 2 85608329 missense probably benign
R7020:Olfr1000 UTSW 2 85608632 missense probably benign 0.11
R7352:Olfr1000 UTSW 2 85608784 missense probably damaging 1.00
R7392:Olfr1000 UTSW 2 85608488 missense possibly damaging 0.61
R7586:Olfr1000 UTSW 2 85608184 missense probably damaging 0.99
R7727:Olfr1000 UTSW 2 85608407 missense possibly damaging 0.72
R8053:Olfr1000 UTSW 2 85608890 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCAAGCTGTAGATGAGGGGATTC -3'
(R):5'- ACACACAACTTTGACCTTTTGC -3'

Sequencing Primer
(F):5'- GGATTCAACATGGGGATCACCAC -3'
(R):5'- ACACAACTTTGACCTTTTGCTTACC -3'
Posted On2019-05-13