Incidental Mutation 'R6991:Eef1a2'
ID543826
Institutional Source Beutler Lab
Gene Symbol Eef1a2
Ensembl Gene ENSMUSG00000016349
Gene Nameeukaryotic translation elongation factor 1 alpha 2
SynonymsEef1a, S1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6991 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location181147653-181157014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 181148628 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 412 (V412L)
Ref Sequence ENSEMBL: ENSMUSP00000054556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055990]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055990
AA Change: V412L

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054556
Gene: ENSMUSG00000016349
AA Change: V412L

DomainStartEndE-ValueType
Pfam:GTP_EFTU 5 238 5.3e-56 PFAM
Pfam:GTP_EFTU_D2 260 327 1.5e-15 PFAM
Pfam:GTP_EFTU_D3 333 442 8.4e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 2) is expressed in brain, heart and skeletal muscle, and the other isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas. This gene may be critical in the development of ovarian cancer. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit muscle wasting, lymphoid hypoplasia, lack of intestinal IgA plasma cells, cerebellar dysfunction, neurodegeneration, an age-dependent increase in chromosomal aberrations, and lethality around 28 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,580,446 V278D probably damaging Het
2410089E03Rik A G 15: 8,252,206 E2843G unknown Het
9930021J03Rik A G 19: 29,719,108 L995S possibly damaging Het
Akap12 G T 10: 4,357,122 E1311* probably null Het
Ankdd1a T A 9: 65,508,675 D186V probably benign Het
Birc6 A G 17: 74,562,095 E346G probably damaging Het
Ccr7 A C 11: 99,145,304 V264G probably damaging Het
Col7a1 T C 9: 108,983,919 probably null Het
Coq8a T C 1: 180,179,068 T132A probably benign Het
Cyp2b10 G A 7: 25,917,355 S407N probably benign Het
Ddi2 A G 4: 141,685,250 V117A probably benign Het
Ddx42 G A 11: 106,239,144 V421I probably damaging Het
Dip2c T A 13: 9,551,860 L285* probably null Het
Dip2c C T 13: 9,634,832 S1232F probably damaging Het
Dner T A 1: 84,476,402 R402* probably null Het
Dpysl3 A T 18: 43,353,891 I317N probably damaging Het
Dusp23 T A 1: 172,631,657 Y146F probably benign Het
Epha7 C T 4: 28,821,489 T218I probably damaging Het
Gigyf2 T A 1: 87,407,136 C284S probably damaging Het
Gm16427 T A 5: 93,484,374 N107I probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hao2 T A 3: 98,876,752 E327V probably damaging Het
Hdhd5 A G 6: 120,510,169 V409A probably damaging Het
Kif9 T C 9: 110,494,622 Y236H probably damaging Het
Kri1 T C 9: 21,287,754 probably benign Het
Lig4 A T 8: 9,971,098 V894E probably damaging Het
Lrriq1 T C 10: 103,187,458 N982S probably damaging Het
Mapk8 T C 14: 33,410,884 I32V possibly damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mstn T C 1: 53,061,941 I59T probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Npw A C 17: 24,658,055 V124G probably benign Het
Nxph3 A G 11: 95,511,418 S57P probably damaging Het
Olfr1000 T C 2: 85,608,248 I221V possibly damaging Het
Olfr1145 G A 2: 87,810,443 D208N possibly damaging Het
Olfr1443 G T 19: 12,680,748 L213F probably benign Het
Olfr493 T A 7: 108,346,088 N298Y possibly damaging Het
Olfr677 T C 7: 105,056,564 I106T probably damaging Het
Opn4 A T 14: 34,593,907 L390M probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2g2e G A 4: 138,880,675 C62Y probably damaging Het
Plcb4 G A 2: 135,910,194 V107M probably damaging Het
Prorsd1 A C 11: 29,514,486 probably benign Het
Prox2 A G 12: 85,087,391 L587P probably benign Het
Prr22 A G 17: 56,771,345 D166G possibly damaging Het
Ptprz1 G A 6: 23,002,687 R1592Q probably benign Het
Rarg C G 15: 102,241,915 R74P probably damaging Het
Rcan1 A G 16: 92,397,363 V54A probably benign Het
Rmdn2 A G 17: 79,621,310 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Serpina1a T C 12: 103,853,833 T385A probably benign Het
Slc44a3 T C 3: 121,532,165 Y12C probably benign Het
Smg1 C A 7: 118,167,868 probably benign Het
Spock3 A G 8: 63,355,381 *437W probably null Het
Sugct T A 13: 17,554,380 Q220H probably benign Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Tnks C A 8: 34,834,493 R1274I probably damaging Het
Trp53bp1 C T 2: 121,208,040 R1439H probably damaging Het
Vmn1r16 G T 6: 57,322,884 S251* probably null Het
Vmn2r15 T A 5: 109,293,314 Q226L probably damaging Het
Vmn2r67 T G 7: 85,155,745 Y53S possibly damaging Het
Vmn2r99 A G 17: 19,378,110 N132S probably benign Het
Wdr73 T G 7: 80,891,856 T313P probably benign Het
Zfp65 C T 13: 67,708,521 R213Q probably damaging Het
Other mutations in Eef1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00741:Eef1a2 APN 2 181153010 missense possibly damaging 0.95
IGL02098:Eef1a2 APN 2 181152789 missense probably benign
IGL02717:Eef1a2 APN 2 181152901 missense probably benign
IGL03264:Eef1a2 APN 2 181148734 missense possibly damaging 0.89
IGL03308:Eef1a2 APN 2 181148836 splice site probably benign
R1680:Eef1a2 UTSW 2 181152941 missense possibly damaging 0.84
R2140:Eef1a2 UTSW 2 181148742 missense probably benign 0.03
R3877:Eef1a2 UTSW 2 181152833 missense probably damaging 0.99
R4706:Eef1a2 UTSW 2 181155357 missense probably damaging 0.96
R4902:Eef1a2 UTSW 2 181148088 missense probably benign 0.02
R5846:Eef1a2 UTSW 2 181152983 missense probably damaging 1.00
R6250:Eef1a2 UTSW 2 181151060 missense possibly damaging 0.70
R6864:Eef1a2 UTSW 2 181149684 missense probably benign 0.00
X0027:Eef1a2 UTSW 2 181151036 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGGAAGTCCCTTAGGCGTTCTTC -3'
(R):5'- ATCATCCTGAACCACCCTGG -3'

Sequencing Primer
(F):5'- GGCGTTCTTCTTCAAAAGAGAAGC -3'
(R):5'- TGGGCAAATCAGCGCTG -3'
Posted On2019-05-13