Incidental Mutation 'R0608:Sycp2'
ID 54384
Institutional Source Beutler Lab
Gene Symbol Sycp2
Ensembl Gene ENSMUSG00000060445
Gene Name synaptonemal complex protein 2
Synonyms 3830402K23Rik, 4930518F03Rik
MMRRC Submission 038797-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0608 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 177987086-178049478 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 178024197 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 396 (F396L)
Ref Sequence ENSEMBL: ENSMUSP00000079909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081134]
AlphaFold Q9CUU3
Predicted Effect probably damaging
Transcript: ENSMUST00000081134
AA Change: F396L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445
AA Change: F396L

DomainStartEndE-ValueType
low complexity region 945 960 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1076 1091 N/A INTRINSIC
low complexity region 1195 1204 N/A INTRINSIC
low complexity region 1273 1293 N/A INTRINSIC
low complexity region 1355 1364 N/A INTRINSIC
coiled coil region 1387 1429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptonemal complex is a proteinaceous structure that links homologous chromosomes during the prophase of meiosis. The protein encoded by this gene is a major component of the synaptonemal complex and may bind DNA at scaffold attachment regions. The encoded protein requires synaptonemal complex protein 3, but not 1, for inclusion in the synaptonemal complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele are sterile due to lack of axial element formation and subsequent failure of chromosome synapsis in prophase I spermatocytes, while females are subfertile with a sharply reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A G 14: 78,748,193 (GRCm39) V1398A probably benign Het
Ampd3 C A 7: 110,394,997 (GRCm39) D315E probably damaging Het
Ampd3 T A 7: 110,394,998 (GRCm39) F316I probably damaging Het
Arhgef40 A C 14: 52,234,431 (GRCm39) E911D probably damaging Het
Atxn2l A G 7: 126,100,588 (GRCm39) probably null Het
Bckdhb T G 9: 83,835,789 (GRCm39) F98V probably damaging Het
Calhm1 C T 19: 47,132,280 (GRCm39) V112I probably benign Het
Ccdc28a G A 10: 18,100,699 (GRCm39) R90C probably damaging Het
Cdc40 A T 10: 40,724,048 (GRCm39) Y247N probably benign Het
Cds1 G A 5: 101,962,299 (GRCm39) V305M probably damaging Het
Cep128 T G 12: 90,966,309 (GRCm39) probably benign Het
Cep72 A T 13: 74,186,423 (GRCm39) H249Q probably damaging Het
Cfap70 A T 14: 20,498,631 (GRCm39) Y19N probably damaging Het
Col11a1 T C 3: 114,012,364 (GRCm39) probably benign Het
Cstdc6 T C 16: 36,143,386 (GRCm39) probably null Het
Cysltr1 A G X: 105,622,261 (GRCm39) V75A possibly damaging Het
Dnaaf11 T A 15: 66,252,323 (GRCm39) M448L probably benign Het
Dnah17 G T 11: 117,981,575 (GRCm39) Y1716* probably null Het
Dnm1 T C 2: 32,225,836 (GRCm39) E383G possibly damaging Het
Dst C A 1: 34,329,437 (GRCm39) probably null Het
Edil3 T C 13: 89,332,968 (GRCm39) S375P probably damaging Het
Eme1 A G 11: 94,540,908 (GRCm39) C277R probably damaging Het
Enam T C 5: 88,640,886 (GRCm39) W183R possibly damaging Het
Fbxl6 C T 15: 76,420,953 (GRCm39) V341M probably benign Het
Fgf14 A G 14: 124,914,015 (GRCm39) S39P probably damaging Het
Fmo4 C T 1: 162,631,220 (GRCm39) R249H possibly damaging Het
Gle1 T A 2: 29,830,240 (GRCm39) D265E probably benign Het
Gml2 T C 15: 74,693,235 (GRCm39) probably null Het
Golgb1 G T 16: 36,736,692 (GRCm39) E1980* probably null Het
Hap1 A G 11: 100,240,131 (GRCm39) L555P probably damaging Het
Heca T C 10: 17,791,039 (GRCm39) D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 (GRCm39) T101A possibly damaging Het
Ift88 T C 14: 57,733,678 (GRCm39) V707A probably benign Het
Kdm3a C T 6: 71,597,030 (GRCm39) G252D probably benign Het
Klhl11 A G 11: 100,363,068 (GRCm39) Y163H probably damaging Het
Kntc1 A T 5: 123,924,137 (GRCm39) N1008Y probably damaging Het
Lrp2 G T 2: 69,316,587 (GRCm39) N2131K probably benign Het
Magi3 C G 3: 103,924,873 (GRCm39) G1092A probably damaging Het
Mef2a G T 7: 66,884,896 (GRCm39) S406* probably null Het
Minar2 A G 18: 59,195,531 (GRCm39) probably null Het
Mrps26 G T 2: 130,405,778 (GRCm39) R27L possibly damaging Het
Myof T C 19: 37,904,952 (GRCm39) D1624G probably damaging Het
Naif1 T C 2: 32,344,908 (GRCm39) M204T probably benign Het
Ndufb8 T C 19: 44,538,784 (GRCm39) E179G possibly damaging Het
Neb A T 2: 52,216,769 (GRCm39) D135E probably benign Het
Nlrp6 C T 7: 140,503,399 (GRCm39) Q502* probably null Het
Nploc4 A G 11: 120,304,507 (GRCm39) L238P probably damaging Het
Obi1 T C 14: 104,716,963 (GRCm39) Y470C probably damaging Het
Or4d2 G A 11: 87,784,022 (GRCm39) H243Y probably damaging Het
Parp4 T A 14: 56,839,861 (GRCm39) V523E probably damaging Het
Pdgfra T C 5: 75,324,438 (GRCm39) Y98H probably damaging Het
Plcz1 C T 6: 139,936,459 (GRCm39) R590H probably damaging Het
Pnliprp1 T A 19: 58,726,628 (GRCm39) Y328* probably null Het
Pnpla8 C T 12: 44,330,246 (GRCm39) P48L probably benign Het
Rab44 T A 17: 29,366,317 (GRCm39) probably null Het
Ranbp2 T C 10: 58,329,720 (GRCm39) I3031T probably damaging Het
Sbno1 T C 5: 124,522,604 (GRCm39) D1072G probably damaging Het
Senp7 A G 16: 55,944,236 (GRCm39) T187A possibly damaging Het
Serpinh1 A G 7: 98,998,601 (GRCm39) C10R unknown Het
Sh2d4a A G 8: 68,799,346 (GRCm39) Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 (GRCm39) D23G probably benign Het
Slc7a7 A G 14: 54,615,259 (GRCm39) L246P probably damaging Het
Spire1 T C 18: 67,661,945 (GRCm39) R163G probably damaging Het
Stxbp2 T A 8: 3,682,559 (GRCm39) D49E probably damaging Het
Susd2 C T 10: 75,474,069 (GRCm39) A509T probably benign Het
Syne2 T C 12: 76,010,587 (GRCm39) L2499P probably damaging Het
Syt10 C A 15: 89,711,144 (GRCm39) A130S probably benign Het
Sytl4 A T X: 132,862,936 (GRCm39) D16E probably benign Het
Tab2 C T 10: 7,795,883 (GRCm39) V126I probably damaging Het
Tecpr1 T C 5: 144,148,317 (GRCm39) T363A probably damaging Het
Terb2 A G 2: 122,016,816 (GRCm39) D16G probably benign Het
Tm2d2 A G 8: 25,510,552 (GRCm39) E137G probably benign Het
Trim30d T A 7: 104,121,692 (GRCm39) H201L probably damaging Het
Tspan3 A G 9: 56,054,669 (GRCm39) probably null Het
Ttn A T 2: 76,617,667 (GRCm39) L16268Q probably damaging Het
Ttn A T 2: 76,626,529 (GRCm39) probably null Het
Ubap2 T A 4: 41,218,319 (GRCm39) T263S probably benign Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Zeb2 A T 2: 44,886,138 (GRCm39) M973K possibly damaging Het
Zfp229 A G 17: 21,965,615 (GRCm39) E615G probably damaging Het
Zfp655 T A 5: 145,180,867 (GRCm39) S242T possibly damaging Het
Zfp788 T A 7: 41,297,705 (GRCm39) F62I possibly damaging Het
Zmynd8 A G 2: 165,629,078 (GRCm39) probably null Het
Other mutations in Sycp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Sycp2 APN 2 178,024,141 (GRCm39) missense probably damaging 1.00
IGL00578:Sycp2 APN 2 177,992,615 (GRCm39) splice site probably benign
IGL00646:Sycp2 APN 2 178,016,252 (GRCm39) missense probably benign 0.00
IGL01309:Sycp2 APN 2 177,999,904 (GRCm39) missense probably benign 0.15
IGL01464:Sycp2 APN 2 178,043,425 (GRCm39) missense probably damaging 0.96
IGL01539:Sycp2 APN 2 178,016,488 (GRCm39) missense probably damaging 1.00
IGL01670:Sycp2 APN 2 178,019,843 (GRCm39) missense probably benign 0.00
IGL02138:Sycp2 APN 2 178,043,783 (GRCm39) nonsense probably null
IGL02138:Sycp2 APN 2 178,000,047 (GRCm39) missense probably benign 0.31
IGL02630:Sycp2 APN 2 178,043,712 (GRCm39) missense probably damaging 1.00
IGL02673:Sycp2 APN 2 178,036,004 (GRCm39) missense possibly damaging 0.63
IGL02961:Sycp2 APN 2 178,022,655 (GRCm39) missense probably benign 0.01
IGL03084:Sycp2 APN 2 178,033,584 (GRCm39) unclassified probably benign
IGL03123:Sycp2 APN 2 177,994,272 (GRCm39) nonsense probably null
IGL03167:Sycp2 APN 2 178,021,291 (GRCm39) missense probably damaging 0.99
R0043:Sycp2 UTSW 2 178,006,504 (GRCm39) missense probably damaging 1.00
R0050:Sycp2 UTSW 2 178,006,504 (GRCm39) missense probably damaging 1.00
R0096:Sycp2 UTSW 2 178,045,528 (GRCm39) missense probably damaging 0.99
R0096:Sycp2 UTSW 2 178,045,528 (GRCm39) missense probably damaging 0.99
R0310:Sycp2 UTSW 2 178,023,648 (GRCm39) missense probably benign 0.44
R0363:Sycp2 UTSW 2 177,988,204 (GRCm39) splice site probably benign
R0456:Sycp2 UTSW 2 178,023,648 (GRCm39) missense probably benign 0.44
R0597:Sycp2 UTSW 2 177,998,373 (GRCm39) missense possibly damaging 0.54
R1112:Sycp2 UTSW 2 177,994,329 (GRCm39) missense probably benign 0.05
R1127:Sycp2 UTSW 2 178,016,159 (GRCm39) missense possibly damaging 0.72
R1208:Sycp2 UTSW 2 177,998,421 (GRCm39) missense possibly damaging 0.92
R1208:Sycp2 UTSW 2 177,998,421 (GRCm39) missense possibly damaging 0.92
R1323:Sycp2 UTSW 2 177,989,414 (GRCm39) missense possibly damaging 0.50
R1323:Sycp2 UTSW 2 177,989,414 (GRCm39) missense possibly damaging 0.50
R1413:Sycp2 UTSW 2 177,989,590 (GRCm39) missense probably benign 0.00
R1557:Sycp2 UTSW 2 178,037,009 (GRCm39) unclassified probably benign
R1562:Sycp2 UTSW 2 178,024,178 (GRCm39) missense probably damaging 1.00
R1585:Sycp2 UTSW 2 177,993,461 (GRCm39) missense possibly damaging 0.50
R1932:Sycp2 UTSW 2 178,023,750 (GRCm39) missense probably damaging 1.00
R1950:Sycp2 UTSW 2 178,044,593 (GRCm39) missense probably benign 0.00
R2001:Sycp2 UTSW 2 178,019,848 (GRCm39) missense probably benign 0.05
R2105:Sycp2 UTSW 2 177,991,931 (GRCm39) splice site probably null
R2382:Sycp2 UTSW 2 178,019,811 (GRCm39) critical splice donor site probably null
R2403:Sycp2 UTSW 2 178,045,528 (GRCm39) nonsense probably null
R2483:Sycp2 UTSW 2 178,016,388 (GRCm39) missense probably damaging 0.98
R3003:Sycp2 UTSW 2 177,999,916 (GRCm39) missense probably benign 0.01
R3418:Sycp2 UTSW 2 178,043,446 (GRCm39) splice site probably benign
R3686:Sycp2 UTSW 2 178,016,177 (GRCm39) missense probably benign 0.16
R4038:Sycp2 UTSW 2 178,022,720 (GRCm39) missense possibly damaging 0.72
R4039:Sycp2 UTSW 2 178,022,720 (GRCm39) missense possibly damaging 0.72
R4272:Sycp2 UTSW 2 178,000,017 (GRCm39) missense probably benign 0.04
R4343:Sycp2 UTSW 2 178,022,740 (GRCm39) missense probably damaging 0.99
R4491:Sycp2 UTSW 2 178,016,778 (GRCm39) missense probably damaging 1.00
R4534:Sycp2 UTSW 2 177,996,802 (GRCm39) missense probably damaging 1.00
R4720:Sycp2 UTSW 2 178,016,225 (GRCm39) missense probably benign 0.11
R4805:Sycp2 UTSW 2 178,035,754 (GRCm39) unclassified probably benign
R4807:Sycp2 UTSW 2 178,035,754 (GRCm39) unclassified probably benign
R4808:Sycp2 UTSW 2 178,035,754 (GRCm39) unclassified probably benign
R4906:Sycp2 UTSW 2 178,045,450 (GRCm39) critical splice donor site probably null
R4910:Sycp2 UTSW 2 178,000,017 (GRCm39) missense probably benign 0.04
R5282:Sycp2 UTSW 2 178,045,554 (GRCm39) missense probably damaging 1.00
R5285:Sycp2 UTSW 2 178,034,191 (GRCm39) splice site probably null
R5316:Sycp2 UTSW 2 177,998,296 (GRCm39) missense probably benign 0.00
R5389:Sycp2 UTSW 2 178,019,495 (GRCm39) splice site probably null
R5621:Sycp2 UTSW 2 178,023,711 (GRCm39) missense probably benign 0.05
R5652:Sycp2 UTSW 2 178,000,498 (GRCm39) splice site probably null
R5880:Sycp2 UTSW 2 178,016,263 (GRCm39) missense possibly damaging 0.92
R6114:Sycp2 UTSW 2 177,990,038 (GRCm39) missense probably benign 0.25
R6115:Sycp2 UTSW 2 177,990,038 (GRCm39) missense probably benign 0.25
R6186:Sycp2 UTSW 2 178,025,353 (GRCm39) missense probably damaging 0.97
R6351:Sycp2 UTSW 2 178,005,209 (GRCm39) missense probably damaging 1.00
R6509:Sycp2 UTSW 2 178,037,687 (GRCm39) missense probably damaging 1.00
R6536:Sycp2 UTSW 2 177,993,441 (GRCm39) missense probably damaging 1.00
R6679:Sycp2 UTSW 2 178,022,721 (GRCm39) missense probably damaging 0.96
R6687:Sycp2 UTSW 2 177,996,753 (GRCm39) missense probably damaging 0.99
R6761:Sycp2 UTSW 2 178,016,144 (GRCm39) splice site probably null
R6786:Sycp2 UTSW 2 178,025,345 (GRCm39) missense possibly damaging 0.63
R7357:Sycp2 UTSW 2 178,045,597 (GRCm39) splice site probably null
R7422:Sycp2 UTSW 2 178,035,944 (GRCm39) missense probably damaging 1.00
R7519:Sycp2 UTSW 2 177,988,126 (GRCm39) makesense probably null
R7805:Sycp2 UTSW 2 178,022,651 (GRCm39) missense probably damaging 0.99
R7960:Sycp2 UTSW 2 178,046,453 (GRCm39) missense probably null 0.90
R8022:Sycp2 UTSW 2 177,996,855 (GRCm39) missense probably damaging 1.00
R8037:Sycp2 UTSW 2 178,045,571 (GRCm39) missense probably damaging 1.00
R8038:Sycp2 UTSW 2 178,045,571 (GRCm39) missense probably damaging 1.00
R8039:Sycp2 UTSW 2 178,016,378 (GRCm39) missense probably benign 0.05
R8159:Sycp2 UTSW 2 177,996,770 (GRCm39) missense probably damaging 0.97
R8233:Sycp2 UTSW 2 177,998,427 (GRCm39) missense probably damaging 1.00
R8436:Sycp2 UTSW 2 178,004,761 (GRCm39) missense probably benign 0.44
R8437:Sycp2 UTSW 2 178,006,651 (GRCm39) missense probably damaging 1.00
R8528:Sycp2 UTSW 2 178,016,326 (GRCm39) missense probably damaging 1.00
R8679:Sycp2 UTSW 2 177,992,768 (GRCm39) missense probably damaging 0.99
R8711:Sycp2 UTSW 2 177,990,088 (GRCm39) missense probably benign 0.41
R8843:Sycp2 UTSW 2 177,990,052 (GRCm39) missense probably damaging 0.99
R9044:Sycp2 UTSW 2 177,989,617 (GRCm39) missense probably damaging 1.00
R9067:Sycp2 UTSW 2 177,989,214 (GRCm39) critical splice donor site probably null
R9203:Sycp2 UTSW 2 177,996,906 (GRCm39) missense probably damaging 1.00
R9263:Sycp2 UTSW 2 178,035,931 (GRCm39) missense probably damaging 1.00
R9301:Sycp2 UTSW 2 178,023,650 (GRCm39) missense probably benign 0.00
R9596:Sycp2 UTSW 2 177,990,212 (GRCm39) critical splice donor site probably null
R9633:Sycp2 UTSW 2 177,998,254 (GRCm39) missense probably damaging 1.00
R9715:Sycp2 UTSW 2 178,035,957 (GRCm39) missense probably damaging 1.00
R9748:Sycp2 UTSW 2 178,025,304 (GRCm39) missense probably damaging 1.00
Z1088:Sycp2 UTSW 2 178,023,727 (GRCm39) missense probably benign 0.17
Z1088:Sycp2 UTSW 2 178,016,160 (GRCm39) missense probably benign
Z1176:Sycp2 UTSW 2 178,006,674 (GRCm39) missense probably damaging 1.00
Z1177:Sycp2 UTSW 2 178,022,668 (GRCm39) missense probably damaging 1.00
Z1191:Sycp2 UTSW 2 177,992,662 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTCATCCTGGCTGCTGCTATT -3'
(R):5'- agagcctgcctcaaagaaaATTTCAAAGA -3'

Sequencing Primer
(F):5'- TGTAAGCAAATTCTGCCACTC -3'
(R):5'- GCAACCCTTGTATAGAAATCAAAATG -3'
Posted On 2013-07-11