Incidental Mutation 'R6991:Tnks'
ID543846
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Nametankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
SynonymsmTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6991 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location34826460-34965690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34834493 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Isoleucine at position 1274 (R1274I)
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
PDB Structure
Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000033929
AA Change: R1274I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: R1274I

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209632
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,580,446 V278D probably damaging Het
2410089E03Rik A G 15: 8,252,206 E2843G unknown Het
9930021J03Rik A G 19: 29,719,108 L995S possibly damaging Het
Akap12 G T 10: 4,357,122 E1311* probably null Het
Ankdd1a T A 9: 65,508,675 D186V probably benign Het
Birc6 A G 17: 74,562,095 E346G probably damaging Het
Ccr7 A C 11: 99,145,304 V264G probably damaging Het
Col7a1 T C 9: 108,983,919 probably null Het
Coq8a T C 1: 180,179,068 T132A probably benign Het
Cyp2b10 G A 7: 25,917,355 S407N probably benign Het
Ddi2 A G 4: 141,685,250 V117A probably benign Het
Ddx42 G A 11: 106,239,144 V421I probably damaging Het
Dip2c T A 13: 9,551,860 L285* probably null Het
Dip2c C T 13: 9,634,832 S1232F probably damaging Het
Dner T A 1: 84,476,402 R402* probably null Het
Dpysl3 A T 18: 43,353,891 I317N probably damaging Het
Dusp23 T A 1: 172,631,657 Y146F probably benign Het
Eef1a2 C A 2: 181,148,628 V412L possibly damaging Het
Epha7 C T 4: 28,821,489 T218I probably damaging Het
Gigyf2 T A 1: 87,407,136 C284S probably damaging Het
Gm16427 T A 5: 93,484,374 N107I probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hao2 T A 3: 98,876,752 E327V probably damaging Het
Hdhd5 A G 6: 120,510,169 V409A probably damaging Het
Kif9 T C 9: 110,494,622 Y236H probably damaging Het
Kri1 T C 9: 21,287,754 probably benign Het
Lig4 A T 8: 9,971,098 V894E probably damaging Het
Lrriq1 T C 10: 103,187,458 N982S probably damaging Het
Mapk8 T C 14: 33,410,884 I32V possibly damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mstn T C 1: 53,061,941 I59T probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Npw A C 17: 24,658,055 V124G probably benign Het
Nxph3 A G 11: 95,511,418 S57P probably damaging Het
Olfr1000 T C 2: 85,608,248 I221V possibly damaging Het
Olfr1145 G A 2: 87,810,443 D208N possibly damaging Het
Olfr1443 G T 19: 12,680,748 L213F probably benign Het
Olfr493 T A 7: 108,346,088 N298Y possibly damaging Het
Olfr677 T C 7: 105,056,564 I106T probably damaging Het
Opn4 A T 14: 34,593,907 L390M probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2g2e G A 4: 138,880,675 C62Y probably damaging Het
Plcb4 G A 2: 135,910,194 V107M probably damaging Het
Prorsd1 A C 11: 29,514,486 probably benign Het
Prox2 A G 12: 85,087,391 L587P probably benign Het
Prr22 A G 17: 56,771,345 D166G possibly damaging Het
Ptprz1 G A 6: 23,002,687 R1592Q probably benign Het
Rarg C G 15: 102,241,915 R74P probably damaging Het
Rcan1 A G 16: 92,397,363 V54A probably benign Het
Rmdn2 A G 17: 79,621,310 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Serpina1a T C 12: 103,853,833 T385A probably benign Het
Slc44a3 T C 3: 121,532,165 Y12C probably benign Het
Smg1 C A 7: 118,167,868 probably benign Het
Spock3 A G 8: 63,355,381 *437W probably null Het
Sugct T A 13: 17,554,380 Q220H probably benign Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Trp53bp1 C T 2: 121,208,040 R1439H probably damaging Het
Vmn1r16 G T 6: 57,322,884 S251* probably null Het
Vmn2r15 T A 5: 109,293,314 Q226L probably damaging Het
Vmn2r67 T G 7: 85,155,745 Y53S possibly damaging Het
Vmn2r99 A G 17: 19,378,110 N132S probably benign Het
Wdr73 T G 7: 80,891,856 T313P probably benign Het
Zfp65 C T 13: 67,708,521 R213Q probably damaging Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 34861689 splice site probably benign
IGL00901:Tnks APN 8 34838395 nonsense probably null
IGL01448:Tnks APN 8 34839982 missense probably damaging 1.00
IGL01455:Tnks APN 8 34940900 missense probably damaging 0.99
IGL01962:Tnks APN 8 34869524 missense probably damaging 1.00
IGL02088:Tnks APN 8 34839994 missense possibly damaging 0.50
IGL02260:Tnks APN 8 34842983 missense probably damaging 0.99
IGL02454:Tnks APN 8 34831728 unclassified probably benign
IGL02486:Tnks APN 8 34851198 missense probably damaging 1.00
IGL02612:Tnks APN 8 34849299 missense possibly damaging 0.48
IGL03179:Tnks APN 8 34848670 missense probably benign 0.38
IGL03404:Tnks APN 8 34940704 missense probably damaging 1.00
R0256:Tnks UTSW 8 34861547 missense probably benign 0.07
R0265:Tnks UTSW 8 34839970 nonsense probably null
R0334:Tnks UTSW 8 34853259 nonsense probably null
R0414:Tnks UTSW 8 34853309 missense probably damaging 1.00
R0526:Tnks UTSW 8 34853303 missense probably benign 0.23
R0622:Tnks UTSW 8 34940822 missense probably damaging 1.00
R1445:Tnks UTSW 8 34834603 splice site probably benign
R1618:Tnks UTSW 8 34875276 missense probably damaging 1.00
R1779:Tnks UTSW 8 34857518 missense probably benign 0.18
R1919:Tnks UTSW 8 34875232 missense probably damaging 1.00
R1938:Tnks UTSW 8 34838530 missense probably damaging 1.00
R2018:Tnks UTSW 8 34851106 missense probably damaging 1.00
R2198:Tnks UTSW 8 34848649 missense probably benign
R2198:Tnks UTSW 8 34873067 missense probably benign 0.29
R2925:Tnks UTSW 8 34965661 missense unknown
R3828:Tnks UTSW 8 34873178 missense probably damaging 1.00
R3913:Tnks UTSW 8 34873074 missense probably damaging 0.99
R3916:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3917:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3930:Tnks UTSW 8 34940812 missense probably damaging 1.00
R4659:Tnks UTSW 8 34849311 missense possibly damaging 0.53
R4760:Tnks UTSW 8 34851783 missense probably benign 0.38
R5091:Tnks UTSW 8 34841809 missense probably benign 0.40
R5419:Tnks UTSW 8 34965566 missense unknown
R5558:Tnks UTSW 8 34965665 start codon destroyed probably null
R5582:Tnks UTSW 8 34940861 missense probably benign 0.14
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6495:Tnks UTSW 8 34839966 critical splice donor site probably null
R6527:Tnks UTSW 8 34873093 missense probably benign 0.36
R7015:Tnks UTSW 8 34838547 missense probably benign 0.04
R7038:Tnks UTSW 8 34851636 missense probably damaging 0.99
R7057:Tnks UTSW 8 34840014 missense probably damaging 1.00
R7167:Tnks UTSW 8 34849304 missense probably damaging 0.98
R7250:Tnks UTSW 8 34851758 missense probably damaging 0.98
R7475:Tnks UTSW 8 34831712 missense probably damaging 1.00
R7790:Tnks UTSW 8 34861540 missense probably benign 0.01
R7818:Tnks UTSW 8 34873028 missense probably benign 0.03
R7909:Tnks UTSW 8 34940704 missense probably damaging 1.00
R7970:Tnks UTSW 8 34855926 critical splice donor site probably null
R8341:Tnks UTSW 8 34873045 missense probably damaging 1.00
R8343:Tnks UTSW 8 34834584 missense probably benign 0.03
Z1177:Tnks UTSW 8 34965145 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGCCTATATCAAGCAGGTCTATTC -3'
(R):5'- CACACAGACTTGAAAGTAGCATTTC -3'

Sequencing Primer
(F):5'- TCAAGCAGGTCTATTCAGAGGTATGC -3'
(R):5'- ACCTGGAGAGGGTCAGCATTTG -3'
Posted On2019-05-13