Incidental Mutation 'R6991:Ddx42'
ID 543859
Institutional Source Beutler Lab
Gene Symbol Ddx42
Ensembl Gene ENSMUSG00000020705
Gene Name DEAD box helicase 42
Synonyms DEAD (Asp-Glu-Ala-Asp) box polypeptide 42, B430002H05Rik, 1810047H21Rik, SF3b125
MMRRC Submission 045097-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6991 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 106107752-106139965 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 106129970 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 421 (V421I)
Ref Sequence ENSEMBL: ENSMUSP00000021046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021046]
AlphaFold Q810A7
Predicted Effect probably damaging
Transcript: ENSMUST00000021046
AA Change: V421I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021046
Gene: ENSMUSG00000020705
AA Change: V421I

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 108 114 N/A INTRINSIC
coiled coil region 116 143 N/A INTRINSIC
low complexity region 149 158 N/A INTRINSIC
DEXDc 272 474 7.61e-68 SMART
HELICc 512 593 1.58e-33 SMART
low complexity region 644 659 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 814 838 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Asp-Glu-Ala-Asp (DEAD) box protein family. Members of this protein family are putative RNA helicases, and are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,279,871 (GRCm39) V278D probably damaging Het
Akap12 G T 10: 4,307,122 (GRCm39) E1311* probably null Het
Ankdd1a T A 9: 65,415,957 (GRCm39) D186V probably benign Het
Birc6 A G 17: 74,869,090 (GRCm39) E346G probably damaging Het
Brd10 A G 19: 29,696,508 (GRCm39) L995S possibly damaging Het
Ccr7 A C 11: 99,036,130 (GRCm39) V264G probably damaging Het
Col7a1 T C 9: 108,812,987 (GRCm39) probably null Het
Coq8a T C 1: 180,006,633 (GRCm39) T132A probably benign Het
Cplane1 A G 15: 8,281,690 (GRCm39) E2843G unknown Het
Cyp2b10 G A 7: 25,616,780 (GRCm39) S407N probably benign Het
Ddi2 A G 4: 141,412,561 (GRCm39) V117A probably benign Het
Dip2c T A 13: 9,601,896 (GRCm39) L285* probably null Het
Dip2c C T 13: 9,684,868 (GRCm39) S1232F probably damaging Het
Dner T A 1: 84,454,123 (GRCm39) R402* probably null Het
Dpysl3 A T 18: 43,486,956 (GRCm39) I317N probably damaging Het
Dusp23 T A 1: 172,459,224 (GRCm39) Y146F probably benign Het
Eef1a2 C A 2: 180,790,421 (GRCm39) V412L possibly damaging Het
Epha7 C T 4: 28,821,489 (GRCm39) T218I probably damaging Het
Gigyf2 T A 1: 87,334,858 (GRCm39) C284S probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,797,390 (GRCm39) probably benign Het
Hao2 T A 3: 98,784,068 (GRCm39) E327V probably damaging Het
Hdhd5 A G 6: 120,487,130 (GRCm39) V409A probably damaging Het
Kif9 T C 9: 110,323,690 (GRCm39) Y236H probably damaging Het
Kri1 T C 9: 21,199,050 (GRCm39) probably benign Het
Lig4 A T 8: 10,021,098 (GRCm39) V894E probably damaging Het
Lrriq1 T C 10: 103,023,319 (GRCm39) N982S probably damaging Het
Mapk8 T C 14: 33,132,841 (GRCm39) I32V possibly damaging Het
Mast4 C T 13: 102,941,155 (GRCm39) V301I probably damaging Het
Mstn T C 1: 53,101,100 (GRCm39) I59T probably benign Het
Mtrf1l T C 10: 5,763,384 (GRCm39) E315G probably damaging Het
Notch4 G T 17: 34,803,774 (GRCm39) E1515* probably null Het
Npw A C 17: 24,877,029 (GRCm39) V124G probably benign Het
Nxph3 A G 11: 95,402,244 (GRCm39) S57P probably damaging Het
Opn4 A T 14: 34,315,864 (GRCm39) L390M probably benign Het
Or12e10 G A 2: 87,640,787 (GRCm39) D208N possibly damaging Het
Or52e4 T C 7: 104,705,771 (GRCm39) I106T probably damaging Het
Or5b95 G T 19: 12,658,112 (GRCm39) L213F probably benign Het
Or5g23 T C 2: 85,438,592 (GRCm39) I221V possibly damaging Het
Or5p68 T A 7: 107,945,295 (GRCm39) N298Y possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pla2g2e G A 4: 138,607,986 (GRCm39) C62Y probably damaging Het
Plcb4 G A 2: 135,752,114 (GRCm39) V107M probably damaging Het
Pramel33 T A 5: 93,632,233 (GRCm39) N107I probably damaging Het
Prorsd1 A C 11: 29,464,486 (GRCm39) probably benign Het
Prox2 A G 12: 85,134,165 (GRCm39) L587P probably benign Het
Prr22 A G 17: 57,078,345 (GRCm39) D166G possibly damaging Het
Ptprz1 G A 6: 23,002,686 (GRCm39) R1592Q probably benign Het
Rarg C G 15: 102,150,350 (GRCm39) R74P probably damaging Het
Rcan1 A G 16: 92,194,251 (GRCm39) V54A probably benign Het
Rmdn2 A G 17: 79,928,739 (GRCm39) probably benign Het
Sec16a G A 2: 26,320,498 (GRCm39) R1361C probably damaging Het
Serpina1a T C 12: 103,820,092 (GRCm39) T385A probably benign Het
Slc44a3 T C 3: 121,325,814 (GRCm39) Y12C probably benign Het
Smg1 C A 7: 117,767,091 (GRCm39) probably benign Het
Spock3 A G 8: 63,808,415 (GRCm39) *437W probably null Het
Sugct T A 13: 17,728,965 (GRCm39) Q220H probably benign Het
Tesk1 A G 4: 43,447,006 (GRCm39) T465A probably benign Het
Tnks C A 8: 35,301,647 (GRCm39) R1274I probably damaging Het
Trp53bp1 C T 2: 121,038,521 (GRCm39) R1439H probably damaging Het
Vmn1r16 G T 6: 57,299,869 (GRCm39) S251* probably null Het
Vmn2r15 T A 5: 109,441,180 (GRCm39) Q226L probably damaging Het
Vmn2r67 T G 7: 84,804,953 (GRCm39) Y53S possibly damaging Het
Vmn2r99 A G 17: 19,598,372 (GRCm39) N132S probably benign Het
Wdr73 T G 7: 80,541,604 (GRCm39) T313P probably benign Het
Zfp65 C T 13: 67,856,640 (GRCm39) R213Q probably damaging Het
Other mutations in Ddx42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Ddx42 APN 11 106,126,575 (GRCm39) missense probably damaging 0.98
IGL00833:Ddx42 APN 11 106,122,004 (GRCm39) missense possibly damaging 0.52
IGL01095:Ddx42 APN 11 106,138,325 (GRCm39) missense probably damaging 1.00
IGL01651:Ddx42 APN 11 106,138,855 (GRCm39) missense probably benign 0.00
IGL01715:Ddx42 APN 11 106,115,101 (GRCm39) missense probably damaging 1.00
IGL02097:Ddx42 APN 11 106,129,986 (GRCm39) missense probably benign 0.00
IGL03182:Ddx42 APN 11 106,138,353 (GRCm39) missense probably benign
P0045:Ddx42 UTSW 11 106,122,098 (GRCm39) missense probably damaging 1.00
R0504:Ddx42 UTSW 11 106,138,675 (GRCm39) missense probably benign 0.03
R0646:Ddx42 UTSW 11 106,123,659 (GRCm39) missense probably benign 0.00
R2277:Ddx42 UTSW 11 106,133,765 (GRCm39) missense probably damaging 1.00
R2279:Ddx42 UTSW 11 106,133,765 (GRCm39) missense probably damaging 1.00
R2297:Ddx42 UTSW 11 106,133,765 (GRCm39) missense probably damaging 1.00
R2336:Ddx42 UTSW 11 106,121,976 (GRCm39) missense possibly damaging 0.56
R2519:Ddx42 UTSW 11 106,136,155 (GRCm39) missense probably damaging 1.00
R3413:Ddx42 UTSW 11 106,138,636 (GRCm39) missense probably benign 0.00
R3498:Ddx42 UTSW 11 106,122,019 (GRCm39) missense possibly damaging 0.90
R3883:Ddx42 UTSW 11 106,138,518 (GRCm39) missense probably benign 0.03
R4421:Ddx42 UTSW 11 106,121,964 (GRCm39) missense probably damaging 1.00
R4696:Ddx42 UTSW 11 106,138,529 (GRCm39) missense probably benign 0.09
R4953:Ddx42 UTSW 11 106,133,766 (GRCm39) missense probably damaging 1.00
R5398:Ddx42 UTSW 11 106,115,724 (GRCm39) missense probably benign
R5669:Ddx42 UTSW 11 106,132,645 (GRCm39) missense probably damaging 1.00
R6091:Ddx42 UTSW 11 106,125,796 (GRCm39) missense probably damaging 1.00
R6139:Ddx42 UTSW 11 106,130,843 (GRCm39) missense probably damaging 1.00
R6643:Ddx42 UTSW 11 106,119,646 (GRCm39) missense probably benign 0.14
R7351:Ddx42 UTSW 11 106,138,508 (GRCm39) missense probably benign
R7502:Ddx42 UTSW 11 106,138,565 (GRCm39) missense probably benign 0.00
R7792:Ddx42 UTSW 11 106,127,822 (GRCm39) missense probably damaging 1.00
R8145:Ddx42 UTSW 11 106,130,887 (GRCm39) missense possibly damaging 0.52
R8425:Ddx42 UTSW 11 106,138,550 (GRCm39) missense probably benign
R9265:Ddx42 UTSW 11 106,132,435 (GRCm39) missense probably benign 0.01
R9523:Ddx42 UTSW 11 106,132,606 (GRCm39) missense probably benign 0.40
R9681:Ddx42 UTSW 11 106,125,679 (GRCm39) missense probably damaging 1.00
RF018:Ddx42 UTSW 11 106,123,630 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCTACTCAGTTCAGCTATGTTGATG -3'
(R):5'- CTCACATCTGATGTCGTCTAAGG -3'

Sequencing Primer
(F):5'- GAGAGTTCTCGGGTAGATTT -3'
(R):5'- CTTTGCAGTACTCATCAGG -3'
Posted On 2019-05-13