Incidental Mutation 'R0608:Magi3'
ID 54386
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Name membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms 4732496O19Rik, 6530407C02Rik
MMRRC Submission 038797-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock # R0608 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 104013259-104220374 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 104017557 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Alanine at position 1092 (G1092A)
Ref Sequence ENSEMBL: ENSMUSP00000113713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303] [ENSMUST00000145727]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000064371
AA Change: G1092A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539
AA Change: G1092A

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121198
AA Change: G1092A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539
AA Change: G1092A

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122303
AA Change: G1092A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539
AA Change: G1092A

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145727
SMART Domains Protein: ENSMUSP00000114722
Gene: ENSMUSG00000058388

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 1.6e-88 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ampd3 C A 7: 110,795,790 D315E probably damaging Het
Ampd3 T A 7: 110,795,791 F316I probably damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atxn2l A G 7: 126,501,416 probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Bckdhb T G 9: 83,953,736 F98V probably damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Ccdc28a G A 10: 18,224,951 R90C probably damaging Het
Cdc40 A T 10: 40,848,052 Y247N probably benign Het
Cds1 G A 5: 101,814,433 V305M probably damaging Het
Cep128 T G 12: 90,999,535 probably benign Het
Cep72 A T 13: 74,038,304 H249Q probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Col11a1 T C 3: 114,218,715 probably benign Het
Cysltr1 A G X: 106,578,655 V75A possibly damaging Het
Dnah17 G T 11: 118,090,749 Y1716* probably null Het
Dnm1 T C 2: 32,335,824 E383G possibly damaging Het
Dst C A 1: 34,290,356 probably null Het
Edil3 T C 13: 89,184,849 S375P probably damaging Het
Eme1 A G 11: 94,650,082 C277R probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Fbxl6 C T 15: 76,536,753 V341M probably benign Het
Fgf14 A G 14: 124,676,603 S39P probably damaging Het
Fmo4 C T 1: 162,803,651 R249H possibly damaging Het
Gle1 T A 2: 29,940,228 D265E probably benign Het
Gml2 T C 15: 74,821,386 probably null Het
Golgb1 G T 16: 36,916,330 E1980* probably null Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Heca T C 10: 17,915,291 D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 T101A possibly damaging Het
Ift88 T C 14: 57,496,221 V707A probably benign Het
Kdm3a C T 6: 71,620,046 G252D probably benign Het
Klhl11 A G 11: 100,472,242 Y163H probably damaging Het
Kntc1 A T 5: 123,786,074 N1008Y probably damaging Het
Lrp2 G T 2: 69,486,243 N2131K probably benign Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrps26 G T 2: 130,563,858 R27L possibly damaging Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Naif1 T C 2: 32,454,896 M204T probably benign Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Neb A T 2: 52,326,757 D135E probably benign Het
Nlrp6 C T 7: 140,923,486 Q502* probably null Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Parp4 T A 14: 56,602,404 V523E probably damaging Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Plcz1 C T 6: 139,990,733 R590H probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Pnpla8 C T 12: 44,283,463 P48L probably benign Het
Rab44 T A 17: 29,147,343 probably null Het
Ranbp2 T C 10: 58,493,898 I3031T probably damaging Het
Rnf219 T C 14: 104,479,527 Y470C probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Serpinh1 A G 7: 99,349,394 C10R unknown Het
Sh2d4a A G 8: 68,346,694 Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spire1 T C 18: 67,528,875 R163G probably damaging Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Susd2 C T 10: 75,638,235 A509T probably benign Het
Sycp2 A G 2: 178,382,404 F396L probably damaging Het
Syne2 T C 12: 75,963,813 L2499P probably damaging Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tab2 C T 10: 7,920,119 V126I probably damaging Het
Tecpr1 T C 5: 144,211,499 T363A probably damaging Het
Terb2 A G 2: 122,186,335 D16G probably benign Het
Tm2d2 A G 8: 25,020,536 E137G probably benign Het
Trim30d T A 7: 104,472,485 H201L probably damaging Het
Tspan3 A G 9: 56,147,385 probably null Het
Ttn A T 2: 76,787,323 L16268Q probably damaging Het
Ttn A T 2: 76,796,185 probably null Het
Ubap2 T A 4: 41,218,319 T263S probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Zeb2 A T 2: 44,996,126 M973K possibly damaging Het
Zfp229 A G 17: 21,746,634 E615G probably damaging Het
Zfp655 T A 5: 145,244,057 S242T possibly damaging Het
Zfp788 T A 7: 41,648,281 F62I possibly damaging Het
Zmynd8 A G 2: 165,787,158 probably null Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 104014978 missense probably damaging 1.00
IGL00933:Magi3 APN 3 104015847 missense probably benign
IGL01151:Magi3 APN 3 104051374 missense probably damaging 1.00
IGL01674:Magi3 APN 3 104105721 splice site probably benign
IGL01790:Magi3 APN 3 104085244 missense probably damaging 1.00
IGL01903:Magi3 APN 3 104051210 missense possibly damaging 0.87
IGL01939:Magi3 APN 3 104054462 missense probably damaging 0.99
IGL02142:Magi3 APN 3 104015903 missense probably benign 0.32
IGL02183:Magi3 APN 3 104085347 missense probably benign 0.01
IGL02887:Magi3 APN 3 104095157 missense probably damaging 1.00
IGL03071:Magi3 APN 3 104015886 missense possibly damaging 0.51
IGL03085:Magi3 APN 3 104015339 missense possibly damaging 0.88
IGL03192:Magi3 APN 3 104043246 missense probably damaging 1.00
IGL03204:Magi3 APN 3 104105835 missense probably damaging 1.00
IGL03227:Magi3 APN 3 104051119 missense probably benign
IGL03388:Magi3 APN 3 104015841 missense probably benign 0.30
PIT4280001:Magi3 UTSW 3 104054352 missense probably damaging 1.00
PIT4504001:Magi3 UTSW 3 104015526 missense probably benign 0.05
R0092:Magi3 UTSW 3 104050964 nonsense probably null
R0514:Magi3 UTSW 3 104015022 missense probably damaging 1.00
R0569:Magi3 UTSW 3 104016042 missense probably benign 0.43
R0920:Magi3 UTSW 3 104034191 splice site probably null
R1173:Magi3 UTSW 3 104061630 critical splice donor site probably null
R1256:Magi3 UTSW 3 104027810 missense probably benign 0.08
R1391:Magi3 UTSW 3 104015058 nonsense probably null
R1559:Magi3 UTSW 3 104046853 splice site probably benign
R1568:Magi3 UTSW 3 104089527 missense probably benign 0.02
R1631:Magi3 UTSW 3 104051177 missense probably benign 0.05
R1747:Magi3 UTSW 3 104034173 missense possibly damaging 0.82
R1930:Magi3 UTSW 3 104089604 missense probably damaging 1.00
R1964:Magi3 UTSW 3 104020402 missense probably damaging 0.99
R2151:Magi3 UTSW 3 104046882 missense probably damaging 1.00
R2151:Magi3 UTSW 3 104085238 missense probably damaging 1.00
R2266:Magi3 UTSW 3 104021066 intron probably benign
R2267:Magi3 UTSW 3 104021066 intron probably benign
R2268:Magi3 UTSW 3 104021066 intron probably benign
R2519:Magi3 UTSW 3 104015765 missense probably benign 0.00
R3104:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3105:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3619:Magi3 UTSW 3 104054405 missense probably damaging 1.00
R4158:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4160:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4284:Magi3 UTSW 3 104015868 nonsense probably null
R4285:Magi3 UTSW 3 104015868 nonsense probably null
R4397:Magi3 UTSW 3 104219714 missense probably damaging 1.00
R4512:Magi3 UTSW 3 104089555 missense probably damaging 0.99
R4676:Magi3 UTSW 3 104015825 missense probably benign
R4758:Magi3 UTSW 3 104015321 missense probably benign 0.01
R4940:Magi3 UTSW 3 104051392 missense probably damaging 1.00
R5039:Magi3 UTSW 3 104105791 missense probably damaging 1.00
R5160:Magi3 UTSW 3 104027908 missense possibly damaging 0.46
R5422:Magi3 UTSW 3 104051368 missense probably damaging 1.00
R5509:Magi3 UTSW 3 104015502 missense probably benign 0.00
R5839:Magi3 UTSW 3 104219731 missense probably damaging 1.00
R5924:Magi3 UTSW 3 104054538 splice site probably null
R6018:Magi3 UTSW 3 104105812 missense probably damaging 1.00
R6189:Magi3 UTSW 3 104050865 missense probably damaging 1.00
R6235:Magi3 UTSW 3 104016068 missense probably damaging 0.99
R6244:Magi3 UTSW 3 104015697 missense probably benign 0.16
R6258:Magi3 UTSW 3 104089596 missense probably damaging 1.00
R6358:Magi3 UTSW 3 104050952 missense probably damaging 1.00
R6534:Magi3 UTSW 3 104085220 missense possibly damaging 0.75
R6806:Magi3 UTSW 3 104046969 missense possibly damaging 0.94
R6816:Magi3 UTSW 3 104089911 splice site probably null
R6897:Magi3 UTSW 3 104089557 missense probably damaging 1.00
R7011:Magi3 UTSW 3 104105754 missense probably damaging 1.00
R7039:Magi3 UTSW 3 104051383 missense probably damaging 1.00
R7196:Magi3 UTSW 3 104049168 missense probably benign 0.01
R7237:Magi3 UTSW 3 104027911 missense probably damaging 1.00
R7285:Magi3 UTSW 3 104034114 missense probably benign 0.00
R7709:Magi3 UTSW 3 104034038 missense probably damaging 1.00
R7724:Magi3 UTSW 3 104015927 missense probably benign 0.04
R7797:Magi3 UTSW 3 104051302 missense probably damaging 1.00
R7950:Magi3 UTSW 3 104016689 missense probably damaging 1.00
R8140:Magi3 UTSW 3 104034086 missense probably damaging 1.00
R8204:Magi3 UTSW 3 104051186 missense probably benign
R8229:Magi3 UTSW 3 104015701 missense possibly damaging 0.79
R8229:Magi3 UTSW 3 104015702 missense probably benign 0.00
R8260:Magi3 UTSW 3 104015309 missense probably benign 0.01
R8348:Magi3 UTSW 3 104051215 missense probably damaging 1.00
R8368:Magi3 UTSW 3 104095063 critical splice donor site probably null
R8543:Magi3 UTSW 3 104219668 missense probably damaging 0.98
R8762:Magi3 UTSW 3 104050853 missense probably damaging 1.00
R8826:Magi3 UTSW 3 104085346 missense probably benign 0.00
R8847:Magi3 UTSW 3 104015018 missense probably benign 0.09
R8892:Magi3 UTSW 3 104050825 missense probably damaging 1.00
R8939:Magi3 UTSW 3 104089432 intron probably benign
R9090:Magi3 UTSW 3 104015948 missense possibly damaging 0.68
R9187:Magi3 UTSW 3 104015757 missense possibly damaging 0.76
R9271:Magi3 UTSW 3 104015948 missense possibly damaging 0.68
R9433:Magi3 UTSW 3 104015157 missense probably benign 0.01
R9439:Magi3 UTSW 3 104015157 missense probably benign 0.01
R9557:Magi3 UTSW 3 104015157 missense probably benign 0.01
R9557:Magi3 UTSW 3 104017617 missense probably damaging 1.00
R9697:Magi3 UTSW 3 104049142 critical splice donor site probably null
R9796:Magi3 UTSW 3 104020975 missense probably benign
X0026:Magi3 UTSW 3 104020420 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCACTTCTGAATTAGCCAGCGATG -3'
(R):5'- AGCTCTTGCTTGAAAGCACCCTTAC -3'

Sequencing Primer
(F):5'- AATTAGCCAGCGATGTGTCC -3'
(R):5'- gcttgatttcaaatgctcagatac -3'
Posted On 2013-07-11