Incidental Mutation 'R6991:Dip2c'
ID 543863
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Name disco interacting protein 2 homolog C
Synonyms 2900024P20Rik
MMRRC Submission 045097-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.590) question?
Stock # R6991 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 9326564-9718964 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 9684868 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 1232 (S1232F)
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
AlphaFold E9PWR4
Predicted Effect probably damaging
Transcript: ENSMUST00000166299
AA Change: S1233F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: S1233F

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169960
AA Change: S1203F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: S1203F

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174552
AA Change: S1232F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: S1232F

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,279,871 (GRCm39) V278D probably damaging Het
Akap12 G T 10: 4,307,122 (GRCm39) E1311* probably null Het
Ankdd1a T A 9: 65,415,957 (GRCm39) D186V probably benign Het
Birc6 A G 17: 74,869,090 (GRCm39) E346G probably damaging Het
Brd10 A G 19: 29,696,508 (GRCm39) L995S possibly damaging Het
Ccr7 A C 11: 99,036,130 (GRCm39) V264G probably damaging Het
Col7a1 T C 9: 108,812,987 (GRCm39) probably null Het
Coq8a T C 1: 180,006,633 (GRCm39) T132A probably benign Het
Cplane1 A G 15: 8,281,690 (GRCm39) E2843G unknown Het
Cyp2b10 G A 7: 25,616,780 (GRCm39) S407N probably benign Het
Ddi2 A G 4: 141,412,561 (GRCm39) V117A probably benign Het
Ddx42 G A 11: 106,129,970 (GRCm39) V421I probably damaging Het
Dner T A 1: 84,454,123 (GRCm39) R402* probably null Het
Dpysl3 A T 18: 43,486,956 (GRCm39) I317N probably damaging Het
Dusp23 T A 1: 172,459,224 (GRCm39) Y146F probably benign Het
Eef1a2 C A 2: 180,790,421 (GRCm39) V412L possibly damaging Het
Epha7 C T 4: 28,821,489 (GRCm39) T218I probably damaging Het
Gigyf2 T A 1: 87,334,858 (GRCm39) C284S probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,797,390 (GRCm39) probably benign Het
Hao2 T A 3: 98,784,068 (GRCm39) E327V probably damaging Het
Hdhd5 A G 6: 120,487,130 (GRCm39) V409A probably damaging Het
Kif9 T C 9: 110,323,690 (GRCm39) Y236H probably damaging Het
Kri1 T C 9: 21,199,050 (GRCm39) probably benign Het
Lig4 A T 8: 10,021,098 (GRCm39) V894E probably damaging Het
Lrriq1 T C 10: 103,023,319 (GRCm39) N982S probably damaging Het
Mapk8 T C 14: 33,132,841 (GRCm39) I32V possibly damaging Het
Mast4 C T 13: 102,941,155 (GRCm39) V301I probably damaging Het
Mstn T C 1: 53,101,100 (GRCm39) I59T probably benign Het
Mtrf1l T C 10: 5,763,384 (GRCm39) E315G probably damaging Het
Notch4 G T 17: 34,803,774 (GRCm39) E1515* probably null Het
Npw A C 17: 24,877,029 (GRCm39) V124G probably benign Het
Nxph3 A G 11: 95,402,244 (GRCm39) S57P probably damaging Het
Opn4 A T 14: 34,315,864 (GRCm39) L390M probably benign Het
Or12e10 G A 2: 87,640,787 (GRCm39) D208N possibly damaging Het
Or52e4 T C 7: 104,705,771 (GRCm39) I106T probably damaging Het
Or5b95 G T 19: 12,658,112 (GRCm39) L213F probably benign Het
Or5g23 T C 2: 85,438,592 (GRCm39) I221V possibly damaging Het
Or5p68 T A 7: 107,945,295 (GRCm39) N298Y possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pla2g2e G A 4: 138,607,986 (GRCm39) C62Y probably damaging Het
Plcb4 G A 2: 135,752,114 (GRCm39) V107M probably damaging Het
Pramel33 T A 5: 93,632,233 (GRCm39) N107I probably damaging Het
Prorsd1 A C 11: 29,464,486 (GRCm39) probably benign Het
Prox2 A G 12: 85,134,165 (GRCm39) L587P probably benign Het
Prr22 A G 17: 57,078,345 (GRCm39) D166G possibly damaging Het
Ptprz1 G A 6: 23,002,686 (GRCm39) R1592Q probably benign Het
Rarg C G 15: 102,150,350 (GRCm39) R74P probably damaging Het
Rcan1 A G 16: 92,194,251 (GRCm39) V54A probably benign Het
Rmdn2 A G 17: 79,928,739 (GRCm39) probably benign Het
Sec16a G A 2: 26,320,498 (GRCm39) R1361C probably damaging Het
Serpina1a T C 12: 103,820,092 (GRCm39) T385A probably benign Het
Slc44a3 T C 3: 121,325,814 (GRCm39) Y12C probably benign Het
Smg1 C A 7: 117,767,091 (GRCm39) probably benign Het
Spock3 A G 8: 63,808,415 (GRCm39) *437W probably null Het
Sugct T A 13: 17,728,965 (GRCm39) Q220H probably benign Het
Tesk1 A G 4: 43,447,006 (GRCm39) T465A probably benign Het
Tnks C A 8: 35,301,647 (GRCm39) R1274I probably damaging Het
Trp53bp1 C T 2: 121,038,521 (GRCm39) R1439H probably damaging Het
Vmn1r16 G T 6: 57,299,869 (GRCm39) S251* probably null Het
Vmn2r15 T A 5: 109,441,180 (GRCm39) Q226L probably damaging Het
Vmn2r67 T G 7: 84,804,953 (GRCm39) Y53S possibly damaging Het
Vmn2r99 A G 17: 19,598,372 (GRCm39) N132S probably benign Het
Wdr73 T G 7: 80,541,604 (GRCm39) T313P probably benign Het
Zfp65 C T 13: 67,856,640 (GRCm39) R213Q probably damaging Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9,543,144 (GRCm39) missense probably damaging 0.97
IGL00426:Dip2c APN 13 9,656,551 (GRCm39) missense probably damaging 1.00
IGL00503:Dip2c APN 13 9,617,934 (GRCm39) missense probably damaging 1.00
IGL00586:Dip2c APN 13 9,660,791 (GRCm39) missense probably damaging 1.00
IGL01306:Dip2c APN 13 9,625,179 (GRCm39) missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9,687,124 (GRCm39) splice site probably null
IGL01985:Dip2c APN 13 9,603,303 (GRCm39) splice site probably benign
IGL02060:Dip2c APN 13 9,672,666 (GRCm39) missense probably damaging 0.98
IGL02122:Dip2c APN 13 9,556,695 (GRCm39) missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9,656,371 (GRCm39) missense probably benign 0.03
IGL02211:Dip2c APN 13 9,660,883 (GRCm39) missense probably damaging 1.00
IGL02755:Dip2c APN 13 9,600,356 (GRCm39) critical splice donor site probably null
IGL02836:Dip2c APN 13 9,660,826 (GRCm39) missense probably damaging 0.98
IGL02935:Dip2c APN 13 9,712,182 (GRCm39) missense probably damaging 1.00
IGL03032:Dip2c APN 13 9,601,814 (GRCm39) missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9,625,179 (GRCm39) missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9,697,018 (GRCm39) missense probably damaging 1.00
R0009:Dip2c UTSW 13 9,671,939 (GRCm39) missense probably damaging 1.00
R0268:Dip2c UTSW 13 9,687,186 (GRCm39) missense probably damaging 1.00
R0271:Dip2c UTSW 13 9,665,811 (GRCm39) missense probably damaging 1.00
R0306:Dip2c UTSW 13 9,654,635 (GRCm39) missense probably benign 0.09
R0415:Dip2c UTSW 13 9,618,325 (GRCm39) splice site probably benign
R0519:Dip2c UTSW 13 9,613,244 (GRCm39) missense probably damaging 1.00
R0557:Dip2c UTSW 13 9,603,495 (GRCm39) missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9,618,699 (GRCm39) missense probably benign 0.43
R0973:Dip2c UTSW 13 9,626,944 (GRCm39) missense probably damaging 0.99
R0973:Dip2c UTSW 13 9,626,944 (GRCm39) missense probably damaging 0.99
R0974:Dip2c UTSW 13 9,626,944 (GRCm39) missense probably damaging 0.99
R1101:Dip2c UTSW 13 9,684,780 (GRCm39) missense probably damaging 1.00
R1171:Dip2c UTSW 13 9,543,162 (GRCm39) missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9,603,300 (GRCm39) splice site probably null
R1403:Dip2c UTSW 13 9,603,300 (GRCm39) splice site probably null
R1432:Dip2c UTSW 13 9,603,340 (GRCm39) missense probably damaging 0.99
R1481:Dip2c UTSW 13 9,601,902 (GRCm39) critical splice donor site probably null
R1588:Dip2c UTSW 13 9,715,900 (GRCm39) missense probably damaging 1.00
R1721:Dip2c UTSW 13 9,709,404 (GRCm39) missense probably damaging 1.00
R1726:Dip2c UTSW 13 9,625,464 (GRCm39) missense probably damaging 1.00
R1867:Dip2c UTSW 13 9,671,985 (GRCm39) missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9,583,386 (GRCm39) missense probably benign 0.00
R2013:Dip2c UTSW 13 9,617,882 (GRCm39) nonsense probably null
R2022:Dip2c UTSW 13 9,601,836 (GRCm39) missense probably damaging 1.00
R2517:Dip2c UTSW 13 9,659,041 (GRCm39) missense probably damaging 1.00
R3746:Dip2c UTSW 13 9,651,509 (GRCm39) missense probably damaging 1.00
R3794:Dip2c UTSW 13 9,654,597 (GRCm39) missense probably damaging 0.99
R3884:Dip2c UTSW 13 9,601,894 (GRCm39) missense probably damaging 1.00
R4019:Dip2c UTSW 13 9,664,401 (GRCm39) missense probably damaging 0.99
R4110:Dip2c UTSW 13 9,687,137 (GRCm39) missense probably damaging 1.00
R4111:Dip2c UTSW 13 9,687,137 (GRCm39) missense probably damaging 1.00
R4113:Dip2c UTSW 13 9,687,137 (GRCm39) missense probably damaging 1.00
R4256:Dip2c UTSW 13 9,659,092 (GRCm39) missense probably damaging 1.00
R4300:Dip2c UTSW 13 9,660,747 (GRCm39) missense probably damaging 1.00
R4494:Dip2c UTSW 13 9,621,098 (GRCm39) missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9,583,375 (GRCm39) missense probably damaging 0.98
R4812:Dip2c UTSW 13 9,687,166 (GRCm39) nonsense probably null
R4814:Dip2c UTSW 13 9,586,896 (GRCm39) missense probably benign 0.07
R4816:Dip2c UTSW 13 9,625,186 (GRCm39) missense probably benign 0.37
R4828:Dip2c UTSW 13 9,610,715 (GRCm39) missense probably damaging 1.00
R4915:Dip2c UTSW 13 9,671,905 (GRCm39) splice site probably null
R4917:Dip2c UTSW 13 9,671,905 (GRCm39) splice site probably null
R4932:Dip2c UTSW 13 9,674,008 (GRCm39) missense probably damaging 0.99
R4993:Dip2c UTSW 13 9,625,259 (GRCm39) nonsense probably null
R5043:Dip2c UTSW 13 9,601,863 (GRCm39) missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9,672,689 (GRCm39) missense probably damaging 1.00
R5744:Dip2c UTSW 13 9,618,441 (GRCm39) missense probably damaging 1.00
R5840:Dip2c UTSW 13 9,556,712 (GRCm39) missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9,673,802 (GRCm39) missense probably damaging 1.00
R6160:Dip2c UTSW 13 9,583,290 (GRCm39) missense probably benign 0.01
R6161:Dip2c UTSW 13 9,697,043 (GRCm39) missense probably damaging 1.00
R6477:Dip2c UTSW 13 9,673,796 (GRCm39) missense probably damaging 1.00
R6522:Dip2c UTSW 13 9,625,264 (GRCm39) critical splice donor site probably null
R6603:Dip2c UTSW 13 9,704,624 (GRCm39) splice site probably null
R6658:Dip2c UTSW 13 9,543,213 (GRCm39) critical splice donor site probably null
R6672:Dip2c UTSW 13 9,617,866 (GRCm39) critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9,671,949 (GRCm39) missense probably damaging 1.00
R6991:Dip2c UTSW 13 9,601,896 (GRCm39) nonsense probably null
R7018:Dip2c UTSW 13 9,709,314 (GRCm39) missense probably damaging 1.00
R7053:Dip2c UTSW 13 9,660,740 (GRCm39) missense probably damaging 1.00
R7102:Dip2c UTSW 13 9,654,572 (GRCm39) missense probably benign 0.01
R7171:Dip2c UTSW 13 9,556,684 (GRCm39) missense probably benign 0.34
R7371:Dip2c UTSW 13 9,642,785 (GRCm39) missense probably benign 0.02
R7395:Dip2c UTSW 13 9,664,413 (GRCm39) missense probably damaging 1.00
R7489:Dip2c UTSW 13 9,583,348 (GRCm39) missense probably damaging 0.99
R7575:Dip2c UTSW 13 9,678,048 (GRCm39) missense probably damaging 0.97
R7642:Dip2c UTSW 13 9,672,741 (GRCm39) critical splice donor site probably null
R7687:Dip2c UTSW 13 9,654,617 (GRCm39) missense probably benign 0.00
R7699:Dip2c UTSW 13 9,709,347 (GRCm39) missense probably benign 0.00
R7700:Dip2c UTSW 13 9,709,347 (GRCm39) missense probably benign 0.00
R7715:Dip2c UTSW 13 9,664,427 (GRCm39) missense probably damaging 1.00
R7842:Dip2c UTSW 13 9,656,569 (GRCm39) critical splice donor site probably null
R7845:Dip2c UTSW 13 9,659,080 (GRCm39) missense probably damaging 1.00
R8354:Dip2c UTSW 13 9,671,918 (GRCm39) missense probably benign 0.05
R8685:Dip2c UTSW 13 9,687,161 (GRCm39) missense probably benign 0.01
R8779:Dip2c UTSW 13 9,660,845 (GRCm39) missense probably damaging 0.98
R8786:Dip2c UTSW 13 9,665,830 (GRCm39) missense probably damaging 0.99
R8815:Dip2c UTSW 13 9,673,834 (GRCm39) nonsense probably null
R8833:Dip2c UTSW 13 9,625,519 (GRCm39) critical splice donor site probably null
R8868:Dip2c UTSW 13 9,625,503 (GRCm39) missense possibly damaging 0.73
R8873:Dip2c UTSW 13 9,625,182 (GRCm39) missense probably benign 0.03
R8887:Dip2c UTSW 13 9,673,989 (GRCm39) splice site probably benign
R8923:Dip2c UTSW 13 9,673,901 (GRCm39) missense probably damaging 1.00
R9112:Dip2c UTSW 13 9,660,766 (GRCm39) missense probably damaging 1.00
R9424:Dip2c UTSW 13 9,709,431 (GRCm39) missense probably damaging 1.00
R9474:Dip2c UTSW 13 9,544,963 (GRCm39) missense unknown
R9527:Dip2c UTSW 13 9,544,875 (GRCm39) missense unknown
R9593:Dip2c UTSW 13 9,704,683 (GRCm39) missense possibly damaging 0.89
R9615:Dip2c UTSW 13 9,625,191 (GRCm39) missense probably benign 0.03
R9801:Dip2c UTSW 13 9,626,936 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACATAGCAAAGTGAAGCAGCTG -3'
(R):5'- ACACGTCAGCTCTTTGGAAG -3'

Sequencing Primer
(F):5'- CAGGGTGAATGTTACTGTCTCTTTCC -3'
(R):5'- GGAATATGCTGCCTCATCAAGTG -3'
Posted On 2019-05-13