Incidental Mutation 'R6991:Golm1'
ID 543865
Institutional Source Beutler Lab
Gene Symbol Golm1
Ensembl Gene ENSMUSG00000021556
Gene Name golgi membrane protein 1
Synonyms Golph2, 2310001L02Rik, D030064E01Rik, PSEC0257, GP73
MMRRC Submission 045097-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R6991 (G1)
Quality Score 217.468
Status Not validated
Chromosome 13
Chromosomal Location 59782810-59823598 bp(-) (GRCm39)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) ACTTCTTCT to ACTTCT at 59797390 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022039] [ENSMUST00000095739]
AlphaFold Q91XA2
Predicted Effect probably benign
Transcript: ENSMUST00000022039
SMART Domains Protein: ENSMUSP00000022039
Gene: ENSMUSG00000021556

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095739
SMART Domains Protein: ENSMUSP00000093410
Gene: ENSMUSG00000021556

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. Alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased premature lethality with kidney abnormalities and liver steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,279,871 (GRCm39) V278D probably damaging Het
Akap12 G T 10: 4,307,122 (GRCm39) E1311* probably null Het
Ankdd1a T A 9: 65,415,957 (GRCm39) D186V probably benign Het
Birc6 A G 17: 74,869,090 (GRCm39) E346G probably damaging Het
Brd10 A G 19: 29,696,508 (GRCm39) L995S possibly damaging Het
Ccr7 A C 11: 99,036,130 (GRCm39) V264G probably damaging Het
Col7a1 T C 9: 108,812,987 (GRCm39) probably null Het
Coq8a T C 1: 180,006,633 (GRCm39) T132A probably benign Het
Cplane1 A G 15: 8,281,690 (GRCm39) E2843G unknown Het
Cyp2b10 G A 7: 25,616,780 (GRCm39) S407N probably benign Het
Ddi2 A G 4: 141,412,561 (GRCm39) V117A probably benign Het
Ddx42 G A 11: 106,129,970 (GRCm39) V421I probably damaging Het
Dip2c T A 13: 9,601,896 (GRCm39) L285* probably null Het
Dip2c C T 13: 9,684,868 (GRCm39) S1232F probably damaging Het
Dner T A 1: 84,454,123 (GRCm39) R402* probably null Het
Dpysl3 A T 18: 43,486,956 (GRCm39) I317N probably damaging Het
Dusp23 T A 1: 172,459,224 (GRCm39) Y146F probably benign Het
Eef1a2 C A 2: 180,790,421 (GRCm39) V412L possibly damaging Het
Epha7 C T 4: 28,821,489 (GRCm39) T218I probably damaging Het
Gigyf2 T A 1: 87,334,858 (GRCm39) C284S probably damaging Het
Hao2 T A 3: 98,784,068 (GRCm39) E327V probably damaging Het
Hdhd5 A G 6: 120,487,130 (GRCm39) V409A probably damaging Het
Kif9 T C 9: 110,323,690 (GRCm39) Y236H probably damaging Het
Kri1 T C 9: 21,199,050 (GRCm39) probably benign Het
Lig4 A T 8: 10,021,098 (GRCm39) V894E probably damaging Het
Lrriq1 T C 10: 103,023,319 (GRCm39) N982S probably damaging Het
Mapk8 T C 14: 33,132,841 (GRCm39) I32V possibly damaging Het
Mast4 C T 13: 102,941,155 (GRCm39) V301I probably damaging Het
Mstn T C 1: 53,101,100 (GRCm39) I59T probably benign Het
Mtrf1l T C 10: 5,763,384 (GRCm39) E315G probably damaging Het
Notch4 G T 17: 34,803,774 (GRCm39) E1515* probably null Het
Npw A C 17: 24,877,029 (GRCm39) V124G probably benign Het
Nxph3 A G 11: 95,402,244 (GRCm39) S57P probably damaging Het
Opn4 A T 14: 34,315,864 (GRCm39) L390M probably benign Het
Or12e10 G A 2: 87,640,787 (GRCm39) D208N possibly damaging Het
Or52e4 T C 7: 104,705,771 (GRCm39) I106T probably damaging Het
Or5b95 G T 19: 12,658,112 (GRCm39) L213F probably benign Het
Or5g23 T C 2: 85,438,592 (GRCm39) I221V possibly damaging Het
Or5p68 T A 7: 107,945,295 (GRCm39) N298Y possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pla2g2e G A 4: 138,607,986 (GRCm39) C62Y probably damaging Het
Plcb4 G A 2: 135,752,114 (GRCm39) V107M probably damaging Het
Pramel33 T A 5: 93,632,233 (GRCm39) N107I probably damaging Het
Prorsd1 A C 11: 29,464,486 (GRCm39) probably benign Het
Prox2 A G 12: 85,134,165 (GRCm39) L587P probably benign Het
Prr22 A G 17: 57,078,345 (GRCm39) D166G possibly damaging Het
Ptprz1 G A 6: 23,002,686 (GRCm39) R1592Q probably benign Het
Rarg C G 15: 102,150,350 (GRCm39) R74P probably damaging Het
Rcan1 A G 16: 92,194,251 (GRCm39) V54A probably benign Het
Rmdn2 A G 17: 79,928,739 (GRCm39) probably benign Het
Sec16a G A 2: 26,320,498 (GRCm39) R1361C probably damaging Het
Serpina1a T C 12: 103,820,092 (GRCm39) T385A probably benign Het
Slc44a3 T C 3: 121,325,814 (GRCm39) Y12C probably benign Het
Smg1 C A 7: 117,767,091 (GRCm39) probably benign Het
Spock3 A G 8: 63,808,415 (GRCm39) *437W probably null Het
Sugct T A 13: 17,728,965 (GRCm39) Q220H probably benign Het
Tesk1 A G 4: 43,447,006 (GRCm39) T465A probably benign Het
Tnks C A 8: 35,301,647 (GRCm39) R1274I probably damaging Het
Trp53bp1 C T 2: 121,038,521 (GRCm39) R1439H probably damaging Het
Vmn1r16 G T 6: 57,299,869 (GRCm39) S251* probably null Het
Vmn2r15 T A 5: 109,441,180 (GRCm39) Q226L probably damaging Het
Vmn2r67 T G 7: 84,804,953 (GRCm39) Y53S possibly damaging Het
Vmn2r99 A G 17: 19,598,372 (GRCm39) N132S probably benign Het
Wdr73 T G 7: 80,541,604 (GRCm39) T313P probably benign Het
Zfp65 C T 13: 67,856,640 (GRCm39) R213Q probably damaging Het
Other mutations in Golm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Golm1 APN 13 59,797,470 (GRCm39) missense probably damaging 0.99
IGL01327:Golm1 APN 13 59,792,958 (GRCm39) missense possibly damaging 0.95
IGL02348:Golm1 APN 13 59,786,191 (GRCm39) missense probably benign 0.00
R0047:Golm1 UTSW 13 59,792,914 (GRCm39) missense probably benign 0.03
R0047:Golm1 UTSW 13 59,792,914 (GRCm39) missense probably benign 0.03
R0458:Golm1 UTSW 13 59,812,178 (GRCm39) missense probably damaging 0.98
R0989:Golm1 UTSW 13 59,787,997 (GRCm39) missense probably benign 0.01
R1301:Golm1 UTSW 13 59,786,187 (GRCm39) missense probably damaging 0.99
R1804:Golm1 UTSW 13 59,790,203 (GRCm39) critical splice acceptor site probably null
R1905:Golm1 UTSW 13 59,790,065 (GRCm39) missense probably benign 0.04
R1940:Golm1 UTSW 13 59,790,051 (GRCm39) splice site probably benign
R2086:Golm1 UTSW 13 59,792,999 (GRCm39) nonsense probably null
R2513:Golm1 UTSW 13 59,790,072 (GRCm39) missense probably benign 0.01
R2887:Golm1 UTSW 13 59,788,044 (GRCm39) missense probably benign 0.00
R3903:Golm1 UTSW 13 59,786,154 (GRCm39) missense probably damaging 1.00
R4154:Golm1 UTSW 13 59,790,167 (GRCm39) missense probably benign 0.01
R5580:Golm1 UTSW 13 59,790,179 (GRCm39) missense probably benign 0.03
R6193:Golm1 UTSW 13 59,792,972 (GRCm39) missense probably benign 0.00
R6418:Golm1 UTSW 13 59,813,375 (GRCm39) missense probably damaging 1.00
R6594:Golm1 UTSW 13 59,812,041 (GRCm39) missense possibly damaging 0.79
R6604:Golm1 UTSW 13 59,786,197 (GRCm39) missense probably damaging 1.00
R6967:Golm1 UTSW 13 59,797,390 (GRCm39) small deletion probably benign
R6968:Golm1 UTSW 13 59,797,390 (GRCm39) small deletion probably benign
R6992:Golm1 UTSW 13 59,797,390 (GRCm39) small deletion probably benign
R6993:Golm1 UTSW 13 59,797,390 (GRCm39) small deletion probably benign
R6996:Golm1 UTSW 13 59,790,058 (GRCm39) missense probably benign 0.00
R7576:Golm1 UTSW 13 59,792,920 (GRCm39) missense probably benign 0.00
R7692:Golm1 UTSW 13 59,788,071 (GRCm39) missense probably benign 0.08
R7863:Golm1 UTSW 13 59,797,383 (GRCm39) missense probably damaging 1.00
R7948:Golm1 UTSW 13 59,812,011 (GRCm39) critical splice donor site probably null
R9519:Golm1 UTSW 13 59,792,914 (GRCm39) missense probably benign
R9703:Golm1 UTSW 13 59,797,433 (GRCm39) missense probably benign 0.39
X0026:Golm1 UTSW 13 59,786,127 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCCATGTGAACATATGCATG -3'
(R):5'- TCAAGGTGCAGGCTTCTGTG -3'

Sequencing Primer
(F):5'- CCATGTGAACATATGCATGCATGTAC -3'
(R):5'- TCTGTAGACCGGACTAGGTTCAAC -3'
Posted On 2019-05-13