Incidental Mutation 'R6991:Zfp65'
ID543866
Institutional Source Beutler Lab
Gene Symbol Zfp65
Ensembl Gene ENSMUSG00000071281
Gene Namezinc finger protein 65
SynonymsZfp71-rs1, KRAB5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R6991 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67705309-67729173 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67708521 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 213 (R213Q)
Ref Sequence ENSEMBL: ENSMUSP00000153058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073157] [ENSMUST00000127979] [ENSMUST00000130891] [ENSMUST00000223829]
Predicted Effect probably damaging
Transcript: ENSMUST00000073157
AA Change: R213Q

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072900
Gene: ENSMUSG00000071281
AA Change: R213Q

DomainStartEndE-ValueType
KRAB 5 65 9.17e-32 SMART
ZnF_C2H2 81 101 1.05e1 SMART
ZnF_C2H2 109 131 8.4e1 SMART
ZnF_C2H2 137 159 3.58e-2 SMART
ZnF_C2H2 165 187 5.99e-4 SMART
ZnF_C2H2 193 215 1.56e-2 SMART
ZnF_C2H2 221 243 1.95e-3 SMART
ZnF_C2H2 249 271 4.79e-3 SMART
ZnF_C2H2 277 299 3.63e-3 SMART
ZnF_C2H2 305 327 8.22e-2 SMART
ZnF_C2H2 333 355 5.9e-3 SMART
ZnF_C2H2 361 383 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127979
SMART Domains Protein: ENSMUSP00000117218
Gene: ENSMUSG00000071281

DomainStartEndE-ValueType
KRAB 2 62 9.17e-32 SMART
ZnF_C2H2 78 98 1.05e1 SMART
ZnF_C2H2 106 128 8.4e1 SMART
ZnF_C2H2 134 156 3.58e-2 SMART
ZnF_C2H2 162 184 5.99e-4 SMART
ZnF_C2H2 190 212 1.56e-2 SMART
ZnF_C2H2 218 240 1.95e-3 SMART
ZnF_C2H2 246 268 4.79e-3 SMART
ZnF_C2H2 274 296 3.63e-3 SMART
ZnF_C2H2 302 324 8.22e-2 SMART
ZnF_C2H2 330 352 5.9e-3 SMART
ZnF_C2H2 358 380 2.57e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000123380
Gene: ENSMUSG00000071281
AA Change: R223Q

DomainStartEndE-ValueType
KRAB 15 75 9.17e-32 SMART
ZnF_C2H2 91 111 1.05e1 SMART
ZnF_C2H2 119 141 8.4e1 SMART
ZnF_C2H2 147 169 3.58e-2 SMART
ZnF_C2H2 175 197 5.99e-4 SMART
ZnF_C2H2 203 225 1.56e-2 SMART
ZnF_C2H2 231 253 1.95e-3 SMART
ZnF_C2H2 259 281 4.79e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223829
AA Change: R213Q

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,580,446 V278D probably damaging Het
2410089E03Rik A G 15: 8,252,206 E2843G unknown Het
9930021J03Rik A G 19: 29,719,108 L995S possibly damaging Het
Akap12 G T 10: 4,357,122 E1311* probably null Het
Ankdd1a T A 9: 65,508,675 D186V probably benign Het
Birc6 A G 17: 74,562,095 E346G probably damaging Het
Ccr7 A C 11: 99,145,304 V264G probably damaging Het
Col7a1 T C 9: 108,983,919 probably null Het
Coq8a T C 1: 180,179,068 T132A probably benign Het
Cyp2b10 G A 7: 25,917,355 S407N probably benign Het
Ddi2 A G 4: 141,685,250 V117A probably benign Het
Ddx42 G A 11: 106,239,144 V421I probably damaging Het
Dip2c C T 13: 9,634,832 S1232F probably damaging Het
Dip2c T A 13: 9,551,860 L285* probably null Het
Dner T A 1: 84,476,402 R402* probably null Het
Dpysl3 A T 18: 43,353,891 I317N probably damaging Het
Dusp23 T A 1: 172,631,657 Y146F probably benign Het
Eef1a2 C A 2: 181,148,628 V412L possibly damaging Het
Epha7 C T 4: 28,821,489 T218I probably damaging Het
Gigyf2 T A 1: 87,407,136 C284S probably damaging Het
Gm16427 T A 5: 93,484,374 N107I probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hao2 T A 3: 98,876,752 E327V probably damaging Het
Hdhd5 A G 6: 120,510,169 V409A probably damaging Het
Kif9 T C 9: 110,494,622 Y236H probably damaging Het
Kri1 T C 9: 21,287,754 probably benign Het
Lig4 A T 8: 9,971,098 V894E probably damaging Het
Lrriq1 T C 10: 103,187,458 N982S probably damaging Het
Mapk8 T C 14: 33,410,884 I32V possibly damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mstn T C 1: 53,061,941 I59T probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Npw A C 17: 24,658,055 V124G probably benign Het
Nxph3 A G 11: 95,511,418 S57P probably damaging Het
Olfr1000 T C 2: 85,608,248 I221V possibly damaging Het
Olfr1145 G A 2: 87,810,443 D208N possibly damaging Het
Olfr1443 G T 19: 12,680,748 L213F probably benign Het
Olfr493 T A 7: 108,346,088 N298Y possibly damaging Het
Olfr677 T C 7: 105,056,564 I106T probably damaging Het
Opn4 A T 14: 34,593,907 L390M probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2g2e G A 4: 138,880,675 C62Y probably damaging Het
Plcb4 G A 2: 135,910,194 V107M probably damaging Het
Prorsd1 A C 11: 29,514,486 probably benign Het
Prox2 A G 12: 85,087,391 L587P probably benign Het
Prr22 A G 17: 56,771,345 D166G possibly damaging Het
Ptprz1 G A 6: 23,002,687 R1592Q probably benign Het
Rarg C G 15: 102,241,915 R74P probably damaging Het
Rcan1 A G 16: 92,397,363 V54A probably benign Het
Rmdn2 A G 17: 79,621,310 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Serpina1a T C 12: 103,853,833 T385A probably benign Het
Slc44a3 T C 3: 121,532,165 Y12C probably benign Het
Smg1 C A 7: 118,167,868 probably benign Het
Spock3 A G 8: 63,355,381 *437W probably null Het
Sugct T A 13: 17,554,380 Q220H probably benign Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Tnks C A 8: 34,834,493 R1274I probably damaging Het
Trp53bp1 C T 2: 121,208,040 R1439H probably damaging Het
Vmn1r16 G T 6: 57,322,884 S251* probably null Het
Vmn2r15 T A 5: 109,293,314 Q226L probably damaging Het
Vmn2r67 T G 7: 85,155,745 Y53S possibly damaging Het
Vmn2r99 A G 17: 19,378,110 N132S probably benign Het
Wdr73 T G 7: 80,891,856 T313P probably benign Het
Other mutations in Zfp65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02094:Zfp65 APN 13 67708185 missense possibly damaging 0.92
IGL02563:Zfp65 APN 13 67708065 missense possibly damaging 0.88
R2142:Zfp65 UTSW 13 67708192 missense probably damaging 1.00
R2169:Zfp65 UTSW 13 67710380 missense probably damaging 1.00
R4702:Zfp65 UTSW 13 67724222 start codon destroyed probably null 0.98
R4770:Zfp65 UTSW 13 67708358 missense probably damaging 1.00
R4836:Zfp65 UTSW 13 67708875 missense probably benign 0.15
R4943:Zfp65 UTSW 13 67710980 missense probably damaging 0.99
R5229:Zfp65 UTSW 13 67708810 missense probably benign 0.02
R6178:Zfp65 UTSW 13 67710318 missense probably benign 0.21
R6786:Zfp65 UTSW 13 67708011 missense probably damaging 1.00
R7896:Zfp65 UTSW 13 67729055 splice site probably null
R8376:Zfp65 UTSW 13 67708918 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAACAGAAGGCCTTCCC -3'
(R):5'- ATGCTATACGTGCACAGAGTG -3'

Sequencing Primer
(F):5'- CCCACATAATTCACACTTGTATGG -3'
(R):5'- TCCCTACAAGTGTGAAGAATGTGCC -3'
Posted On2019-05-13