Incidental Mutation 'R6991:Opn4'
ID543869
Institutional Source Beutler Lab
Gene Symbol Opn4
Ensembl Gene ENSMUSG00000021799
Gene Nameopsin 4 (melanopsin)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6991 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location34590618-34600142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34593907 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 390 (L390M)
Ref Sequence ENSEMBL: ENSMUSP00000126136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022331] [ENSMUST00000168444]
Predicted Effect probably benign
Transcript: ENSMUST00000022331
AA Change: L390M

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022331
Gene: ENSMUSG00000021799
AA Change: L390M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 77 324 6.9e-10 PFAM
Pfam:7TM_GPCR_Srsx 80 362 8.3e-13 PFAM
Pfam:7tm_1 86 347 2.9e-58 PFAM
Pfam:7TM_GPCR_Srv 108 362 1.5e-6 PFAM
low complexity region 383 401 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168444
AA Change: L390M

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126136
Gene: ENSMUSG00000021799
AA Change: L390M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 77 324 1.1e-9 PFAM
Pfam:7TM_GPCR_Srsx 80 362 6.1e-13 PFAM
Pfam:7tm_1 86 347 2.6e-64 PFAM
Pfam:7TM_GPCR_Srv 108 362 1.2e-6 PFAM
low complexity region 383 401 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. This gene encodes a photoreceptive opsin protein that is expressed within the ganglion and amacrine cell layers of the retina. In mouse, retinal ganglion cell axons expressing this gene projected to the suprachiasmatic nucleus and other brain nuclei involved in circadian photoentrainment. In mouse, this protein is coupled to a transient receptor potential (TRP) ion channel through a G protein signaling pathway and produces a physiologic light response via membrane depolarization and increased intracellular calcium. The protein functions as a sensory photopigment and may also have photoisomerase activity. Experiments with knockout mice indicate that this gene attenuates, but does not abolish, photoentrainment. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in absent intrinsic inner retinal photosensitivity, abnormal pupillary reflex, and abnormal circadian rhythms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,580,446 V278D probably damaging Het
2410089E03Rik A G 15: 8,252,206 E2843G unknown Het
9930021J03Rik A G 19: 29,719,108 L995S possibly damaging Het
Akap12 G T 10: 4,357,122 E1311* probably null Het
Ankdd1a T A 9: 65,508,675 D186V probably benign Het
Birc6 A G 17: 74,562,095 E346G probably damaging Het
Ccr7 A C 11: 99,145,304 V264G probably damaging Het
Col7a1 T C 9: 108,983,919 probably null Het
Coq8a T C 1: 180,179,068 T132A probably benign Het
Cyp2b10 G A 7: 25,917,355 S407N probably benign Het
Ddi2 A G 4: 141,685,250 V117A probably benign Het
Ddx42 G A 11: 106,239,144 V421I probably damaging Het
Dip2c T A 13: 9,551,860 L285* probably null Het
Dip2c C T 13: 9,634,832 S1232F probably damaging Het
Dner T A 1: 84,476,402 R402* probably null Het
Dpysl3 A T 18: 43,353,891 I317N probably damaging Het
Dusp23 T A 1: 172,631,657 Y146F probably benign Het
Eef1a2 C A 2: 181,148,628 V412L possibly damaging Het
Epha7 C T 4: 28,821,489 T218I probably damaging Het
Gigyf2 T A 1: 87,407,136 C284S probably damaging Het
Gm16427 T A 5: 93,484,374 N107I probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hao2 T A 3: 98,876,752 E327V probably damaging Het
Hdhd5 A G 6: 120,510,169 V409A probably damaging Het
Kif9 T C 9: 110,494,622 Y236H probably damaging Het
Kri1 T C 9: 21,287,754 probably benign Het
Lig4 A T 8: 9,971,098 V894E probably damaging Het
Lrriq1 T C 10: 103,187,458 N982S probably damaging Het
Mapk8 T C 14: 33,410,884 I32V possibly damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mstn T C 1: 53,061,941 I59T probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Npw A C 17: 24,658,055 V124G probably benign Het
Nxph3 A G 11: 95,511,418 S57P probably damaging Het
Olfr1000 T C 2: 85,608,248 I221V possibly damaging Het
Olfr1145 G A 2: 87,810,443 D208N possibly damaging Het
Olfr1443 G T 19: 12,680,748 L213F probably benign Het
Olfr493 T A 7: 108,346,088 N298Y possibly damaging Het
Olfr677 T C 7: 105,056,564 I106T probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2g2e G A 4: 138,880,675 C62Y probably damaging Het
Plcb4 G A 2: 135,910,194 V107M probably damaging Het
Prorsd1 A C 11: 29,514,486 probably benign Het
Prox2 A G 12: 85,087,391 L587P probably benign Het
Prr22 A G 17: 56,771,345 D166G possibly damaging Het
Ptprz1 G A 6: 23,002,687 R1592Q probably benign Het
Rarg C G 15: 102,241,915 R74P probably damaging Het
Rcan1 A G 16: 92,397,363 V54A probably benign Het
Rmdn2 A G 17: 79,621,310 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Serpina1a T C 12: 103,853,833 T385A probably benign Het
Slc44a3 T C 3: 121,532,165 Y12C probably benign Het
Smg1 C A 7: 118,167,868 probably benign Het
Spock3 A G 8: 63,355,381 *437W probably null Het
Sugct T A 13: 17,554,380 Q220H probably benign Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Tnks C A 8: 34,834,493 R1274I probably damaging Het
Trp53bp1 C T 2: 121,208,040 R1439H probably damaging Het
Vmn1r16 G T 6: 57,322,884 S251* probably null Het
Vmn2r15 T A 5: 109,293,314 Q226L probably damaging Het
Vmn2r67 T G 7: 85,155,745 Y53S possibly damaging Het
Vmn2r99 A G 17: 19,378,110 N132S probably benign Het
Wdr73 T G 7: 80,891,856 T313P probably benign Het
Zfp65 C T 13: 67,708,521 R213Q probably damaging Het
Other mutations in Opn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01872:Opn4 APN 14 34597209 splice site probably benign
IGL02628:Opn4 APN 14 34593057 missense probably benign 0.15
R0308:Opn4 UTSW 14 34597124 missense possibly damaging 0.79
R0586:Opn4 UTSW 14 34598973 splice site probably benign
R2022:Opn4 UTSW 14 34597071 missense probably benign 0.25
R2860:Opn4 UTSW 14 34593828 critical splice donor site probably null
R2861:Opn4 UTSW 14 34593828 critical splice donor site probably null
R2862:Opn4 UTSW 14 34593828 critical splice donor site probably null
R3976:Opn4 UTSW 14 34597109 missense probably benign 0.12
R4007:Opn4 UTSW 14 34599832 missense probably benign 0.41
R4837:Opn4 UTSW 14 34596304 missense probably damaging 1.00
R5287:Opn4 UTSW 14 34592937 missense probably benign 0.01
R5403:Opn4 UTSW 14 34592937 missense probably benign 0.01
R6252:Opn4 UTSW 14 34594831 missense probably benign 0.22
R7065:Opn4 UTSW 14 34595877 missense probably benign 0.06
R7761:Opn4 UTSW 14 34598852 missense probably benign 0.00
Z1177:Opn4 UTSW 14 34599838 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCCAGTCTAACATGTGGCTC -3'
(R):5'- ACCTAGCTGTCTGTCTGAGC -3'

Sequencing Primer
(F):5'- TCTGCCACCCAGGTCCAG -3'
(R):5'- TGTCTGAGCCCATCACCAGTG -3'
Posted On2019-05-13