Incidental Mutation 'R6991:Rarg'
ID543871
Institutional Source Beutler Lab
Gene Symbol Rarg
Ensembl Gene ENSMUSG00000001288
Gene Nameretinoic acid receptor, gamma
SynonymsRAR gamma 2, RARgamma2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.802) question?
Stock #R6991 (G1)
Quality Score178.009
Status Not validated
Chromosome15
Chromosomal Location102234938-102257517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 102241915 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 74 (R74P)
Ref Sequence ENSEMBL: ENSMUSP00000067266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043172] [ENSMUST00000063339] [ENSMUST00000130204] [ENSMUST00000135466] [ENSMUST00000155563]
Predicted Effect probably benign
Transcript: ENSMUST00000043172
AA Change: R85P

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000048838
Gene: ENSMUSG00000001288
AA Change: R85P

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
low complexity region 75 84 N/A INTRINSIC
ZnF_C4 87 158 1.53e-40 SMART
HOLI 232 390 9.07e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063339
AA Change: R74P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067266
Gene: ENSMUSG00000001288
AA Change: R74P

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
ZnF_C4 76 147 1.53e-40 SMART
HOLI 221 379 9.07e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130204
Predicted Effect probably benign
Transcript: ENSMUST00000135466
AA Change: R85P

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118615
Gene: ENSMUSG00000001288
AA Change: R85P

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
low complexity region 75 84 N/A INTRINSIC
ZnF_C4 87 158 1.53e-40 SMART
PDB:1EXX|A 178 227 5e-28 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000155563
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retinoic acid receptor that belongs to the nuclear hormone receptor family. Retinoic acid receptors (RARs) act as ligand-dependent transcriptional regulators. When bound to ligands, RARs activate transcription by binding as heterodimers to the retinoic acid response elements (RARE) found in the promoter regions of the target genes. In their unbound form, RARs repress transcription of their target genes. RARs are involved in various biological processes, including limb bud development, skeletal growth, and matrix homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit stunted growth, homeotic transformations of the rostral axial skeleton and tracheal cartilage, Harderian gland agenesis, high postnatal mortality, and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,580,446 V278D probably damaging Het
2410089E03Rik A G 15: 8,252,206 E2843G unknown Het
9930021J03Rik A G 19: 29,719,108 L995S possibly damaging Het
Akap12 G T 10: 4,357,122 E1311* probably null Het
Ankdd1a T A 9: 65,508,675 D186V probably benign Het
Birc6 A G 17: 74,562,095 E346G probably damaging Het
Ccr7 A C 11: 99,145,304 V264G probably damaging Het
Col7a1 T C 9: 108,983,919 probably null Het
Coq8a T C 1: 180,179,068 T132A probably benign Het
Cyp2b10 G A 7: 25,917,355 S407N probably benign Het
Ddi2 A G 4: 141,685,250 V117A probably benign Het
Ddx42 G A 11: 106,239,144 V421I probably damaging Het
Dip2c T A 13: 9,551,860 L285* probably null Het
Dip2c C T 13: 9,634,832 S1232F probably damaging Het
Dner T A 1: 84,476,402 R402* probably null Het
Dpysl3 A T 18: 43,353,891 I317N probably damaging Het
Dusp23 T A 1: 172,631,657 Y146F probably benign Het
Eef1a2 C A 2: 181,148,628 V412L possibly damaging Het
Epha7 C T 4: 28,821,489 T218I probably damaging Het
Gigyf2 T A 1: 87,407,136 C284S probably damaging Het
Gm16427 T A 5: 93,484,374 N107I probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hao2 T A 3: 98,876,752 E327V probably damaging Het
Hdhd5 A G 6: 120,510,169 V409A probably damaging Het
Kif9 T C 9: 110,494,622 Y236H probably damaging Het
Kri1 T C 9: 21,287,754 probably benign Het
Lig4 A T 8: 9,971,098 V894E probably damaging Het
Lrriq1 T C 10: 103,187,458 N982S probably damaging Het
Mapk8 T C 14: 33,410,884 I32V possibly damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mstn T C 1: 53,061,941 I59T probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Npw A C 17: 24,658,055 V124G probably benign Het
Nxph3 A G 11: 95,511,418 S57P probably damaging Het
Olfr1000 T C 2: 85,608,248 I221V possibly damaging Het
Olfr1145 G A 2: 87,810,443 D208N possibly damaging Het
Olfr1443 G T 19: 12,680,748 L213F probably benign Het
Olfr493 T A 7: 108,346,088 N298Y possibly damaging Het
Olfr677 T C 7: 105,056,564 I106T probably damaging Het
Opn4 A T 14: 34,593,907 L390M probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2g2e G A 4: 138,880,675 C62Y probably damaging Het
Plcb4 G A 2: 135,910,194 V107M probably damaging Het
Prorsd1 A C 11: 29,514,486 probably benign Het
Prox2 A G 12: 85,087,391 L587P probably benign Het
Prr22 A G 17: 56,771,345 D166G possibly damaging Het
Ptprz1 G A 6: 23,002,687 R1592Q probably benign Het
Rcan1 A G 16: 92,397,363 V54A probably benign Het
Rmdn2 A G 17: 79,621,310 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Serpina1a T C 12: 103,853,833 T385A probably benign Het
Slc44a3 T C 3: 121,532,165 Y12C probably benign Het
Smg1 C A 7: 118,167,868 probably benign Het
Spock3 A G 8: 63,355,381 *437W probably null Het
Sugct T A 13: 17,554,380 Q220H probably benign Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Tnks C A 8: 34,834,493 R1274I probably damaging Het
Trp53bp1 C T 2: 121,208,040 R1439H probably damaging Het
Vmn1r16 G T 6: 57,322,884 S251* probably null Het
Vmn2r15 T A 5: 109,293,314 Q226L probably damaging Het
Vmn2r67 T G 7: 85,155,745 Y53S possibly damaging Het
Vmn2r99 A G 17: 19,378,110 N132S probably benign Het
Wdr73 T G 7: 80,891,856 T313P probably benign Het
Zfp65 C T 13: 67,708,521 R213Q probably damaging Het
Other mutations in Rarg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02877:Rarg APN 15 102241939 splice site probably null
R0033:Rarg UTSW 15 102238835 missense probably damaging 0.99
R0539:Rarg UTSW 15 102238877 missense probably damaging 1.00
R1137:Rarg UTSW 15 102241160 missense probably damaging 1.00
R1593:Rarg UTSW 15 102239941 missense probably damaging 1.00
R1916:Rarg UTSW 15 102252445 missense probably benign 0.00
R1926:Rarg UTSW 15 102239545 missense probably damaging 1.00
R2057:Rarg UTSW 15 102239504 missense probably damaging 0.99
R2211:Rarg UTSW 15 102239524 missense probably benign 0.20
R4581:Rarg UTSW 15 102252551 missense possibly damaging 0.70
R5718:Rarg UTSW 15 102241067 missense probably damaging 1.00
R6197:Rarg UTSW 15 102241892 missense possibly damaging 0.94
R7300:Rarg UTSW 15 102252417 critical splice donor site probably null
R8104:Rarg UTSW 15 102239899 missense probably damaging 1.00
R8121:Rarg UTSW 15 102239958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAACACAGTACCTGGGC -3'
(R):5'- GCTACAAAGAGTGGTGGTCTG -3'

Sequencing Primer
(F):5'- CCTGGAACTAGCTCTGTAGACTAG -3'
(R):5'- TGGGCTTTCCAGGGAGTACC -3'
Posted On2019-05-13