Incidental Mutation 'R6991:Rmdn2'
ID543878
Institutional Source Beutler Lab
Gene Symbol Rmdn2
Ensembl Gene ENSMUSG00000036368
Gene Nameregulator of microtubule dynamics 2
SynonymsFam82a1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6991 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location79611863-79693192 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to G at 79621310 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040368] [ENSMUST00000223924] [ENSMUST00000224014] [ENSMUST00000225357]
Predicted Effect probably benign
Transcript: ENSMUST00000040368
SMART Domains Protein: ENSMUSP00000044543
Gene: ENSMUSG00000036368

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
Blast:PAS 70 133 4e-16 BLAST
low complexity region 137 149 N/A INTRINSIC
SCOP:d1hxia_ 290 386 4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086570
SMART Domains Protein: ENSMUSP00000083761
Gene: ENSMUSG00000036368

DomainStartEndE-ValueType
low complexity region 195 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223924
Predicted Effect probably benign
Transcript: ENSMUST00000224014
Predicted Effect probably benign
Transcript: ENSMUST00000225357
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T A 7: 27,580,446 V278D probably damaging Het
2410089E03Rik A G 15: 8,252,206 E2843G unknown Het
9930021J03Rik A G 19: 29,719,108 L995S possibly damaging Het
Akap12 G T 10: 4,357,122 E1311* probably null Het
Ankdd1a T A 9: 65,508,675 D186V probably benign Het
Birc6 A G 17: 74,562,095 E346G probably damaging Het
Ccr7 A C 11: 99,145,304 V264G probably damaging Het
Col7a1 T C 9: 108,983,919 probably null Het
Coq8a T C 1: 180,179,068 T132A probably benign Het
Cyp2b10 G A 7: 25,917,355 S407N probably benign Het
Ddi2 A G 4: 141,685,250 V117A probably benign Het
Ddx42 G A 11: 106,239,144 V421I probably damaging Het
Dip2c T A 13: 9,551,860 L285* probably null Het
Dip2c C T 13: 9,634,832 S1232F probably damaging Het
Dner T A 1: 84,476,402 R402* probably null Het
Dpysl3 A T 18: 43,353,891 I317N probably damaging Het
Dusp23 T A 1: 172,631,657 Y146F probably benign Het
Eef1a2 C A 2: 181,148,628 V412L possibly damaging Het
Epha7 C T 4: 28,821,489 T218I probably damaging Het
Gigyf2 T A 1: 87,407,136 C284S probably damaging Het
Gm16427 T A 5: 93,484,374 N107I probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hao2 T A 3: 98,876,752 E327V probably damaging Het
Hdhd5 A G 6: 120,510,169 V409A probably damaging Het
Kif9 T C 9: 110,494,622 Y236H probably damaging Het
Kri1 T C 9: 21,287,754 probably benign Het
Lig4 A T 8: 9,971,098 V894E probably damaging Het
Lrriq1 T C 10: 103,187,458 N982S probably damaging Het
Mapk8 T C 14: 33,410,884 I32V possibly damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mstn T C 1: 53,061,941 I59T probably benign Het
Mtrf1l T C 10: 5,813,384 E315G probably damaging Het
Notch4 G T 17: 34,584,800 E1515* probably null Het
Npw A C 17: 24,658,055 V124G probably benign Het
Nxph3 A G 11: 95,511,418 S57P probably damaging Het
Olfr1000 T C 2: 85,608,248 I221V possibly damaging Het
Olfr1145 G A 2: 87,810,443 D208N possibly damaging Het
Olfr1443 G T 19: 12,680,748 L213F probably benign Het
Olfr493 T A 7: 108,346,088 N298Y possibly damaging Het
Olfr677 T C 7: 105,056,564 I106T probably damaging Het
Opn4 A T 14: 34,593,907 L390M probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2g2e G A 4: 138,880,675 C62Y probably damaging Het
Plcb4 G A 2: 135,910,194 V107M probably damaging Het
Prorsd1 A C 11: 29,514,486 probably benign Het
Prox2 A G 12: 85,087,391 L587P probably benign Het
Prr22 A G 17: 56,771,345 D166G possibly damaging Het
Ptprz1 G A 6: 23,002,687 R1592Q probably benign Het
Rarg C G 15: 102,241,915 R74P probably damaging Het
Rcan1 A G 16: 92,397,363 V54A probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Serpina1a T C 12: 103,853,833 T385A probably benign Het
Slc44a3 T C 3: 121,532,165 Y12C probably benign Het
Smg1 C A 7: 118,167,868 probably benign Het
Spock3 A G 8: 63,355,381 *437W probably null Het
Sugct T A 13: 17,554,380 Q220H probably benign Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Tnks C A 8: 34,834,493 R1274I probably damaging Het
Trp53bp1 C T 2: 121,208,040 R1439H probably damaging Het
Vmn1r16 G T 6: 57,322,884 S251* probably null Het
Vmn2r15 T A 5: 109,293,314 Q226L probably damaging Het
Vmn2r67 T G 7: 85,155,745 Y53S possibly damaging Het
Vmn2r99 A G 17: 19,378,110 N132S probably benign Het
Wdr73 T G 7: 80,891,856 T313P probably benign Het
Zfp65 C T 13: 67,708,521 R213Q probably damaging Het
Other mutations in Rmdn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01628:Rmdn2 APN 17 79672388 nonsense probably null
R0052:Rmdn2 UTSW 17 79650331 missense probably damaging 0.99
R0052:Rmdn2 UTSW 17 79650331 missense probably damaging 0.99
R0127:Rmdn2 UTSW 17 79670569 missense probably damaging 1.00
R0206:Rmdn2 UTSW 17 79650287 splice site probably benign
R0440:Rmdn2 UTSW 17 79667955 missense probably damaging 1.00
R0720:Rmdn2 UTSW 17 79668029 critical splice donor site probably null
R1163:Rmdn2 UTSW 17 79659451 missense probably benign 0.00
R3746:Rmdn2 UTSW 17 79670552 splice site probably null
R4966:Rmdn2 UTSW 17 79666875 missense probably damaging 1.00
R5137:Rmdn2 UTSW 17 79667989 missense probably benign 0.02
R5259:Rmdn2 UTSW 17 79668017 missense probably damaging 1.00
R6439:Rmdn2 UTSW 17 79627542 intron probably benign
R7046:Rmdn2 UTSW 17 79621379 missense probably damaging 1.00
R7322:Rmdn2 UTSW 17 79621611 missense probably damaging 1.00
R7541:Rmdn2 UTSW 17 79627868 missense
Predicted Primers PCR Primer
(F):5'- AAGTCCGTATTGAAGTAGACTCCTG -3'
(R):5'- AAAGACCACCGATGCTCCTTG -3'

Sequencing Primer
(F):5'- TTGAAGTAGACTCCTGTAATAGTCC -3'
(R):5'- TTCCTCTGGCAGAGTTAGTGAACC -3'
Posted On2019-05-13