Mutagenetix > Incidental Mutation

Incidental Mutation 'R6992:Frem1'

543889

Institutional Source

Beutler Lab

Gene Symbol

Frem1

Ensembl Gene

ENSMUSG00000059049

Gene Name

Fras1 related extracellular matrix protein 1

Synonyms

eyes2, heb, eye, crf11, QBRICK

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.667) question?

Stock #

R6992 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

82897920-83052339 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 82940362 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1622 (V1622A)

Ref Sequence

ENSEMBL: ENSMUSP00000071627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]

AlphaFold

Q684R7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071708
AA Change: V1622A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: V1622A

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Cadherin_3	364	508	1.7e-37	PFAM
Pfam:Cadherin_3	509	623	3.7e-18	PFAM
Pfam:Cadherin_3	592	709	8.4e-16	PFAM
Pfam:Cadherin_3	746	894	4.8e-26	PFAM
Pfam:Cadherin_3	863	1009	2.8e-30	PFAM
Pfam:Cadherin_3	1024	1115	6.4e-13	PFAM
Pfam:Cadherin_3	1119	1252	1.4e-17	PFAM
Pfam:Cadherin_3	1243	1393	8.2e-35	PFAM
Pfam:Cadherin_3	1378	1506	2e-22	PFAM
Pfam:Cadherin_3	1506	1616	1e-29	PFAM
Pfam:Cadherin_3	1617	1744	1.5e-14	PFAM
Pfam:Calx-beta	1749	1848	2.6e-10	PFAM
low complexity region	1894	1910	N/A	INTRINSIC
CLECT	2065	2188	2.25e-27	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107230
AA Change: V1603A

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: V1603A

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
internal_repeat_1	296	967	9.01e-39	PROSPERO
internal_repeat_1	1026	1705	9.01e-39	PROSPERO
Pfam:Calx-beta	1730	1829	6.7e-10	PFAM
low complexity region	1875	1891	N/A	INTRINSIC
CLECT	2046	2169	2.25e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127886

SMART Domains

Protein: ENSMUSP00000122467
Gene: ENSMUSG00000059049

Domain	Start	End	E-Value	Type
Pfam:Cadherin_3	26	158	1.1e-18	PFAM
Pfam:Cadherin_3	150	300	4.6e-36	PFAM
Pfam:Cadherin_3	285	408	6e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170248
AA Change: V1604A

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: V1604A

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Cadherin_3	365	509	1.3e-37	PFAM
Pfam:Cadherin_3	510	623	4.5e-18	PFAM
Pfam:Cadherin_3	593	711	6.1e-16	PFAM
Pfam:Cadherin_3	728	876	2.7e-27	PFAM
Pfam:Cadherin_3	845	991	2.1e-30	PFAM
Pfam:Cadherin_3	1006	1097	4.8e-13	PFAM
Pfam:Cadherin_3	1101	1234	1e-17	PFAM
Pfam:Cadherin_3	1225	1375	6.1e-35	PFAM
Pfam:Cadherin_3	1360	1488	1.5e-22	PFAM
Pfam:Cadherin_3	1488	1598	7.5e-30	PFAM
Pfam:Cadherin_3	1599	1726	1.1e-14	PFAM
Pfam:Calx-beta	1731	1830	6.4e-10	PFAM
low complexity region	1876	1892	N/A	INTRINSIC
CLECT	2047	2170	2.25e-27	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	T	C	9: 92,354,672	M128T	probably benign	Het
4921539E11Rik	C	T	4: 103,242,793	S171N	possibly damaging	Het
6030468B19Rik	T	G	11: 117,797,768	M1R	probably null	Het
9530053A07Rik	T	A	7: 28,140,183	F474I	probably benign	Het
A730049H05Rik	T	C	6: 92,827,994		probably benign	Het
AC125199.3	G	T	16: 88,812,027	H52Q	possibly damaging	Het
Adam34	A	T	8: 43,652,605	M1K	probably null	Het
Adgrf5	T	C	17: 43,452,323		probably null	Het
Antxr2	T	C	5: 97,960,705	T316A	probably benign	Het
Cc2d1a	A	T	8: 84,134,913	V714D	probably damaging	Het
Cd96	A	G	16: 46,049,724	S461P	possibly damaging	Het
Cdc16	C	A	8: 13,759,188	A51E	probably benign	Het
Chd4	T	A	6: 125,114,376	D1243E	probably benign	Het
Cntf	A	T	19: 12,765,333	I21N	probably damaging	Het
Col11a2	C	T	17: 34,047,144	A282V	probably benign	Het
Col14a1	T	A	15: 55,411,562		probably null	Het
Cyp2b9	T	C	7: 26,201,139	Y401H	probably benign	Het
Dlgap4	A	G	2: 156,748,940		probably null	Het
Fancd2	T	C	6: 113,571,018		probably null	Het
Golm1	ACTTCTTCT	ACTTCT	13: 59,649,576		probably benign	Het
Gstm4	A	G	3: 108,044,665	M3T	possibly damaging	Het
Hdac10	T	C	15: 89,125,331	D466G	probably benign	Het
Hook2	A	G	8: 85,002,556	E625G	probably damaging	Het
Hspbp1	G	C	7: 4,664,715	P260A	probably benign	Het
Igdcc3	C	A	9: 65,181,571	Q411K	probably damaging	Het
Il18rap	G	A	1: 40,542,035	E356K	probably benign	Het
Inpp4a	A	T	1: 37,389,691	M699L	probably damaging	Het
Klhdc1	A	G	12: 69,253,757	H157R	probably damaging	Het
Klhl6	G	T	16: 19,953,587	T336N	probably damaging	Het
March7	T	C	2: 60,229,084		probably null	Het
Mast4	C	T	13: 102,804,647	V301I	probably damaging	Het
Mlh3	T	A	12: 85,235,720	N1412Y	probably damaging	Het
Mrps27	A	G	13: 99,405,014	M209V	probably benign	Het
Mtor	A	T	4: 148,464,475	T572S	probably benign	Het
Neurog1	T	C	13: 56,251,550	K128R	probably damaging	Het
Olfr124	T	A	17: 37,805,863	N239K	probably damaging	Het
Olfr1484	A	G	19: 13,585,447	I48V	possibly damaging	Het
Olfr981	T	A	9: 40,022,600	L69*	probably null	Het
Pcdhgb1	A	G	18: 37,681,599	K381R	probably benign	Het
Pdzd2	T	C	15: 12,457,859	D306G	probably damaging	Het
Plekha5	C	T	6: 140,543,908	T237I	probably damaging	Het
Pole	A	T	5: 110,332,499	I103F	probably damaging	Het
Ppfia2	A	T	10: 106,474,854	Q74L	possibly damaging	Het
Ppm1d	T	C	11: 85,332,352	F261S	probably damaging	Het
Psg21	A	T	7: 18,654,743		probably null	Het
Ptprg	T	A	14: 11,962,602	F133L	probably damaging	Het
Rom1	G	A	19: 8,929,205		probably benign	Het
Rtn3	A	G	19: 7,435,124	F762L	probably damaging	Het
Sec23ip	T	C	7: 128,765,440	S600P	probably benign	Het
Sema4b	T	A	7: 80,220,152	I396N	probably damaging	Het
Serpina3k	T	A	12: 104,341,107	D199E	probably benign	Het
Slc19a1	A	G	10: 77,049,706	D480G	possibly damaging	Het
Slc8b1	G	A	5: 120,527,815	V404M	probably damaging	Het
Slco1a4	T	C	6: 141,819,604	D304G	probably benign	Het
Smpdl3b	G	T	4: 132,745,141	A107D	possibly damaging	Het
Tesk1	A	G	4: 43,447,006	T465A	probably benign	Het
Tmem245	A	G	4: 56,937,940	F203L	probably benign	Het
Tnip1	T	A	11: 54,918,716	I442F	probably benign	Het
Txnip	A	G	3: 96,559,123	K127R	possibly damaging	Het
Usp32	A	C	11: 85,032,088	L172R	probably damaging	Het
Vmn2r66	A	G	7: 85,005,228	S508P	possibly damaging	Het
Vwa5b2	T	A	16: 20,598,202	Y550N	probably damaging	Het
Wdr81	G	A	11: 75,451,786	A885V	probably benign	Het

Other mutations in Frem1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Frem1	APN	4	82959389	missense	possibly damaging	0.46
IGL01069:Frem1	APN	4	83013867	missense	probably benign	0.00
IGL01106:Frem1	APN	4	82922257	missense	probably benign	0.00
IGL01398:Frem1	APN	4	82950362	missense	possibly damaging	0.64
IGL01617:Frem1	APN	4	82936139	missense	probably benign	0.02
IGL01647:Frem1	APN	4	82950356	missense	possibly damaging	0.60
IGL01690:Frem1	APN	4	82959296	splice site	probably benign
IGL02006:Frem1	APN	4	82992800	critical splice donor site	probably null
IGL02069:Frem1	APN	4	82903551	missense	probably damaging	1.00
IGL02131:Frem1	APN	4	82924854	missense	probably benign	0.03
IGL02225:Frem1	APN	4	82940506	missense	probably damaging	1.00
IGL02439:Frem1	APN	4	82956345	missense	probably benign	0.00
IGL02567:Frem1	APN	4	83000055	missense	probably damaging	1.00
IGL02647:Frem1	APN	4	83001754	missense	probably damaging	1.00
IGL02653:Frem1	APN	4	82959334	missense	probably benign	0.22
IGL02831:Frem1	APN	4	82956158	missense	probably benign	0.31
IGL02997:Frem1	APN	4	82934968	missense	probably damaging	1.00
IGL03005:Frem1	APN	4	82994134	missense	probably damaging	1.00
IGL03036:Frem1	APN	4	82959339	missense	possibly damaging	0.55
IGL03193:Frem1	APN	4	82994026	splice site	probably benign
IGL03218:Frem1	APN	4	82914646	missense	probably benign	0.00
IGL03235:Frem1	APN	4	83020755	missense	possibly damaging	0.87
IGL03243:Frem1	APN	4	83013969	missense	probably damaging	1.00
bat	UTSW	4	82983060	intron	probably benign
blister	UTSW	4	83020770	missense	probably benign	0.28
boy	UTSW	4	82956255	missense	probably benign	0.16
Bubblie	UTSW	4	82970633	critical splice donor site	probably null
magicbear	UTSW	4	83001820	missense	probably damaging	1.00
major	UTSW	4	82989189	missense	probably damaging	1.00
R6324_Frem1_643	UTSW	4	82983337	missense	probably benign	0.00
PIT4131001:Frem1	UTSW	4	83005808	missense	probably damaging	0.99
PIT4466001:Frem1	UTSW	4	82972137	missense	probably benign	0.01
PIT4472001:Frem1	UTSW	4	82972137	missense	probably benign	0.01
PIT4515001:Frem1	UTSW	4	82900426	missense	probably damaging	0.98
PIT4531001:Frem1	UTSW	4	82950280	missense	probably benign	0.12
R0010:Frem1	UTSW	4	83000098	missense	probably benign	0.41
R0010:Frem1	UTSW	4	83000098	missense	probably benign	0.41
R0115:Frem1	UTSW	4	82936169	missense	possibly damaging	0.94
R0125:Frem1	UTSW	4	83011951	missense	probably damaging	1.00
R0280:Frem1	UTSW	4	82969444	missense	probably damaging	1.00
R0504:Frem1	UTSW	4	82912637	missense	probably benign	0.26
R0519:Frem1	UTSW	4	82970633	critical splice donor site	probably null
R0631:Frem1	UTSW	4	82972165	missense	probably damaging	1.00
R0645:Frem1	UTSW	4	82989166	missense	probably damaging	1.00
R0781:Frem1	UTSW	4	82950320	missense	probably damaging	0.99
R1110:Frem1	UTSW	4	82950320	missense	probably damaging	0.99
R1115:Frem1	UTSW	4	83020770	missense	probably benign	0.28
R1130:Frem1	UTSW	4	82916628	splice site	probably null
R1173:Frem1	UTSW	4	82950352	missense	probably benign	0.16
R1349:Frem1	UTSW	4	82922305	splice site	probably benign
R1464:Frem1	UTSW	4	83011879	missense	probably damaging	1.00
R1464:Frem1	UTSW	4	83011879	missense	probably damaging	1.00
R1658:Frem1	UTSW	4	83001808	missense	probably damaging	1.00
R1672:Frem1	UTSW	4	82998891	missense	probably benign	0.09
R1831:Frem1	UTSW	4	83020837	missense	possibly damaging	0.95
R1851:Frem1	UTSW	4	82950500	missense	probably damaging	0.98
R2014:Frem1	UTSW	4	83005852	missense	probably damaging	1.00
R2021:Frem1	UTSW	4	82913558	missense	probably benign	0.02
R2022:Frem1	UTSW	4	82913558	missense	probably benign	0.02
R2023:Frem1	UTSW	4	82913558	missense	probably benign	0.02
R2183:Frem1	UTSW	4	82991495	missense	probably benign	0.00
R2437:Frem1	UTSW	4	83000173	missense	probably damaging	1.00
R2520:Frem1	UTSW	4	82950290	missense	probably damaging	0.99
R3195:Frem1	UTSW	4	83014114	missense	probably damaging	0.99
R3196:Frem1	UTSW	4	83014114	missense	probably damaging	0.99
R3408:Frem1	UTSW	4	83011986	missense	probably damaging	1.00
R3411:Frem1	UTSW	4	82963179	missense	possibly damaging	0.51
R3742:Frem1	UTSW	4	83011867	missense	probably damaging	1.00
R3829:Frem1	UTSW	4	82998930	missense	probably damaging	1.00
R3888:Frem1	UTSW	4	82913607	missense	probably benign	0.41
R4329:Frem1	UTSW	4	82986537	missense	probably benign	0.01
R4364:Frem1	UTSW	4	82913251	missense	probably damaging	0.99
R4411:Frem1	UTSW	4	82963244	missense	probably damaging	1.00
R4624:Frem1	UTSW	4	82989106	missense	probably damaging	1.00
R4687:Frem1	UTSW	4	83020631	missense	probably damaging	1.00
R4764:Frem1	UTSW	4	82989189	missense	probably damaging	1.00
R4801:Frem1	UTSW	4	82916628	splice site	probably benign
R4802:Frem1	UTSW	4	82916628	splice site	probably benign
R4854:Frem1	UTSW	4	82916758	missense	possibly damaging	0.88
R4872:Frem1	UTSW	4	82963150	missense	probably damaging	1.00
R4947:Frem1	UTSW	4	82966134	missense	probably damaging	0.99
R5007:Frem1	UTSW	4	82940812	intron	probably benign
R5103:Frem1	UTSW	4	82991612	missense	probably benign
R5369:Frem1	UTSW	4	83001739	missense	possibly damaging	0.61
R5494:Frem1	UTSW	4	82940753	makesense	probably null
R5694:Frem1	UTSW	4	82994116	missense	probably damaging	1.00
R5780:Frem1	UTSW	4	82950415	missense	probably benign	0.12
R5813:Frem1	UTSW	4	83000158	missense	probably damaging	1.00
R5843:Frem1	UTSW	4	82936052	missense	probably damaging	1.00
R5914:Frem1	UTSW	4	83001775	missense	probably damaging	1.00
R5985:Frem1	UTSW	4	82966050	missense	probably benign
R6091:Frem1	UTSW	4	82900559	missense	probably benign	0.01
R6165:Frem1	UTSW	4	82956255	missense	probably benign	0.16
R6324:Frem1	UTSW	4	82983337	missense	probably benign	0.00
R6369:Frem1	UTSW	4	82913792	splice site	probably null
R6414:Frem1	UTSW	4	82940536	missense	probably damaging	0.98
R6421:Frem1	UTSW	4	82994128	missense	probably damaging	1.00
R6434:Frem1	UTSW	4	82966016	missense	probably benign	0.03
R6453:Frem1	UTSW	4	82914825	nonsense	probably null
R6598:Frem1	UTSW	4	83013828	missense	probably damaging	0.99
R6720:Frem1	UTSW	4	83013832	missense	probably damaging	0.98
R6862:Frem1	UTSW	4	83012014	nonsense	probably null
R6922:Frem1	UTSW	4	82922269	missense	probably damaging	1.00
R6931:Frem1	UTSW	4	82970677	missense	probably damaging	1.00
R6995:Frem1	UTSW	4	82986601	missense	probably damaging	1.00
R7001:Frem1	UTSW	4	82986561	missense	probably benign	0.44
R7104:Frem1	UTSW	4	82940681	missense	probably benign	0.30
R7146:Frem1	UTSW	4	82922295	missense	possibly damaging	0.93
R7174:Frem1	UTSW	4	82922256	missense	probably benign	0.00
R7327:Frem1	UTSW	4	83020755	missense	possibly damaging	0.87
R7343:Frem1	UTSW	4	82994122	missense	probably damaging	0.99
R7368:Frem1	UTSW	4	82966144	missense	probably benign	0.19
R7392:Frem1	UTSW	4	83013827	missense	probably benign	0.06
R7465:Frem1	UTSW	4	82914835	missense	probably benign	0.11
R7499:Frem1	UTSW	4	83005770	missense	probably damaging	1.00
R7536:Frem1	UTSW	4	82956195	missense	probably damaging	1.00
R7752:Frem1	UTSW	4	82959377	missense	probably benign	0.02
R7753:Frem1	UTSW	4	82913980	missense	probably benign	0.03
R7790:Frem1	UTSW	4	82989164	missense	probably benign	0.02
R7818:Frem1	UTSW	4	83014008	missense	probably damaging	1.00
R7877:Frem1	UTSW	4	83013812	critical splice donor site	probably null
R7878:Frem1	UTSW	4	83020680	missense	probably benign	0.00
R7886:Frem1	UTSW	4	83016406	missense	possibly damaging	0.68
R7901:Frem1	UTSW	4	82959377	missense	probably benign	0.02
R7976:Frem1	UTSW	4	83001709	missense	probably damaging	0.97
R8240:Frem1	UTSW	4	82956248	missense	probably benign	0.21
R8305:Frem1	UTSW	4	82999989	missense	probably benign	0.06
R8415:Frem1	UTSW	4	83000262	missense	probably damaging	1.00
R8751:Frem1	UTSW	4	82970778	missense	probably damaging	1.00
R8819:Frem1	UTSW	4	82903517	missense	probably damaging	1.00
R8820:Frem1	UTSW	4	82903517	missense	probably damaging	1.00
R8829:Frem1	UTSW	4	83000194	missense	probably damaging	1.00
R8834:Frem1	UTSW	4	83004373	missense	probably damaging	1.00
R8857:Frem1	UTSW	4	83004043	intron	probably benign
R8910:Frem1	UTSW	4	82950457	missense	probably benign	0.09
R9036:Frem1	UTSW	4	82913548	missense	probably benign
R9228:Frem1	UTSW	4	83001820	missense	probably damaging	1.00
R9382:Frem1	UTSW	4	82983385	missense	possibly damaging	0.79
R9441:Frem1	UTSW	4	83005846	missense	probably damaging	1.00
R9492:Frem1	UTSW	4	83001820	missense	probably damaging	1.00
R9517:Frem1	UTSW	4	82983477	missense	probably damaging	1.00
R9640:Frem1	UTSW	4	82913659	missense	probably benign
R9641:Frem1	UTSW	4	82959416	missense	probably damaging	1.00
X0013:Frem1	UTSW	4	82914808	missense	probably benign	0.38
X0017:Frem1	UTSW	4	82991633	critical splice acceptor site	probably null
Z1088:Frem1	UTSW	4	82972267	missense	probably damaging	1.00
Z1176:Frem1	UTSW	4	82999983	missense	probably damaging	1.00
Z1177:Frem1	UTSW	4	82940315	critical splice donor site	probably null
Z1177:Frem1	UTSW	4	83000269	missense	probably benign	0.39
Z1177:Frem1	UTSW	4	83016464	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACCACATTCTGCAGGCATG -3'
(R):5'- AGAACCTGACCTTCTTTCTGG -3'

Sequencing Primer
(F):5'- TTAGACCCCAGTTGGTGAAC -3'
(R):5'- TCTGGCTCAGCTCCCACG -3'

Posted On

2019-05-13