Mutagenetix > Incidental Mutation

Incidental Mutation 'R0608:Ubap2'

54389

Institutional Source

Beutler Lab

Gene Symbol

Ubap2

Ensembl Gene

ENSMUSG00000028433

Gene Name

ubiquitin-associated protein 2

Synonyms

1190005K07Rik

MMRRC Submission

038797-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.206) question?

Stock #

R0608 (G1)

Quality Score

133

Status

Not validated

Chromosome

Chromosomal Location

41194313-41275144 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 41218319 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 263 (T263S)

Ref Sequence

ENSEMBL: ENSMUSP00000103703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030143] [ENSMUST00000108068] [ENSMUST00000135323]

AlphaFold

Q91VX2

Predicted Effect

probably benign
Transcript: ENSMUST00000030143
AA Change: T264S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000030143
Gene: ENSMUSG00000028433
AA Change: T264S

Domain	Start	End	E-Value	Type
UBA	53	91	9.62e-8	SMART
low complexity region	115	127	N/A	INTRINSIC
low complexity region	130	144	N/A	INTRINSIC
low complexity region	166	185	N/A	INTRINSIC
low complexity region	256	266	N/A	INTRINSIC
low complexity region	341	358	N/A	INTRINSIC
low complexity region	436	448	N/A	INTRINSIC
Pfam:DUF3697	512	544	1.5e-18	PFAM
low complexity region	583	618	N/A	INTRINSIC
low complexity region	631	644	N/A	INTRINSIC
low complexity region	696	722	N/A	INTRINSIC
low complexity region	744	768	N/A	INTRINSIC
low complexity region	787	800	N/A	INTRINSIC
low complexity region	888	914	N/A	INTRINSIC
low complexity region	1007	1024	N/A	INTRINSIC
low complexity region	1057	1078	N/A	INTRINSIC
low complexity region	1084	1098	N/A	INTRINSIC
low complexity region	1101	1115	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108068
AA Change: T263S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000103703
Gene: ENSMUSG00000028433
AA Change: T263S

Domain	Start	End	E-Value	Type
UBA	52	90	9.62e-8	SMART
low complexity region	114	126	N/A	INTRINSIC
low complexity region	129	143	N/A	INTRINSIC
low complexity region	165	184	N/A	INTRINSIC
low complexity region	255	265	N/A	INTRINSIC
low complexity region	340	357	N/A	INTRINSIC
low complexity region	435	447	N/A	INTRINSIC
Pfam:DUF3697	511	543	1.2e-20	PFAM
low complexity region	582	617	N/A	INTRINSIC
low complexity region	630	643	N/A	INTRINSIC
low complexity region	695	721	N/A	INTRINSIC
low complexity region	743	767	N/A	INTRINSIC
low complexity region	786	799	N/A	INTRINSIC
low complexity region	887	913	N/A	INTRINSIC
low complexity region	1006	1023	N/A	INTRINSIC
low complexity region	1056	1077	N/A	INTRINSIC
low complexity region	1083	1097	N/A	INTRINSIC
low complexity region	1100	1114	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132499

Predicted Effect

probably benign
Transcript: ENSMUST00000134782

SMART Domains

Protein: ENSMUSP00000121724
Gene: ENSMUSG00000028433

Domain	Start	End	E-Value	Type
low complexity region	33	45	N/A	INTRINSIC
UBA	61	99	9.62e-8	SMART
low complexity region	123	135	N/A	INTRINSIC
low complexity region	138	152	N/A	INTRINSIC
low complexity region	174	193	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135323

SMART Domains

Protein: ENSMUSP00000122256
Gene: ENSMUSG00000028433

Domain	Start	End	E-Value	Type
low complexity region	74	91	N/A	INTRINSIC
low complexity region	169	181	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177331

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.7%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBA (ubiquitin associated) domain, which is characteristic of proteins that function in the ubiquitination pathway. This gene may show increased expression in the adrenal gland and lymphatic tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730017C20Rik	A	G	18: 59,062,459		probably null	Het
Akap11	A	G	14: 78,510,753	V1398A	probably benign	Het
Ampd3	C	A	7: 110,795,790	D315E	probably damaging	Het
Ampd3	T	A	7: 110,795,791	F316I	probably damaging	Het
Arhgef40	A	C	14: 51,996,974	E911D	probably damaging	Het
Atxn2l	A	G	7: 126,501,416		probably null	Het
BC117090	T	C	16: 36,323,024		probably null	Het
Bckdhb	T	G	9: 83,953,736	F98V	probably damaging	Het
Calhm1	C	T	19: 47,143,841	V112I	probably benign	Het
Ccdc28a	G	A	10: 18,224,951	R90C	probably damaging	Het
Cdc40	A	T	10: 40,848,052	Y247N	probably benign	Het
Cds1	G	A	5: 101,814,433	V305M	probably damaging	Het
Cep128	T	G	12: 90,999,535		probably benign	Het
Cep72	A	T	13: 74,038,304	H249Q	probably damaging	Het
Cfap70	A	T	14: 20,448,563	Y19N	probably damaging	Het
Col11a1	T	C	3: 114,218,715		probably benign	Het
Cysltr1	A	G	X: 106,578,655	V75A	possibly damaging	Het
Dnah17	G	T	11: 118,090,749	Y1716*	probably null	Het
Dnm1	T	C	2: 32,335,824	E383G	possibly damaging	Het
Dst	C	A	1: 34,290,356		probably null	Het
Edil3	T	C	13: 89,184,849	S375P	probably damaging	Het
Eme1	A	G	11: 94,650,082	C277R	probably damaging	Het
Enam	T	C	5: 88,493,027	W183R	possibly damaging	Het
Fbxl6	C	T	15: 76,536,753	V341M	probably benign	Het
Fgf14	A	G	14: 124,676,603	S39P	probably damaging	Het
Fmo4	C	T	1: 162,803,651	R249H	possibly damaging	Het
Gle1	T	A	2: 29,940,228	D265E	probably benign	Het
Gml2	T	C	15: 74,821,386		probably null	Het
Golgb1	G	T	16: 36,916,330	E1980*	probably null	Het
Hap1	A	G	11: 100,349,305	L555P	probably damaging	Het
Heca	T	C	10: 17,915,291	D339G	possibly damaging	Het
Hepacam2	T	C	6: 3,483,479	T101A	possibly damaging	Het
Ift88	T	C	14: 57,496,221	V707A	probably benign	Het
Kdm3a	C	T	6: 71,620,046	G252D	probably benign	Het
Klhl11	A	G	11: 100,472,242	Y163H	probably damaging	Het
Kntc1	A	T	5: 123,786,074	N1008Y	probably damaging	Het
Lrp2	G	T	2: 69,486,243	N2131K	probably benign	Het
Lrrc6	T	A	15: 66,380,474	M448L	probably benign	Het
Magi3	C	G	3: 104,017,557	G1092A	probably damaging	Het
Mef2a	G	T	7: 67,235,148	S406*	probably null	Het
Mrps26	G	T	2: 130,563,858	R27L	possibly damaging	Het
Myof	T	C	19: 37,916,504	D1624G	probably damaging	Het
Naif1	T	C	2: 32,454,896	M204T	probably benign	Het
Ndufb8	T	C	19: 44,550,345	E179G	possibly damaging	Het
Neb	A	T	2: 52,326,757	D135E	probably benign	Het
Nlrp6	C	T	7: 140,923,486	Q502*	probably null	Het
Nploc4	A	G	11: 120,413,681	L238P	probably damaging	Het
Olfr463	G	A	11: 87,893,196	H243Y	probably damaging	Het
Parp4	T	A	14: 56,602,404	V523E	probably damaging	Het
Pdgfra	T	C	5: 75,163,777	Y98H	probably damaging	Het
Plcz1	C	T	6: 139,990,733	R590H	probably damaging	Het
Pnliprp1	T	A	19: 58,738,196	Y328*	probably null	Het
Pnpla8	C	T	12: 44,283,463	P48L	probably benign	Het
Rab44	T	A	17: 29,147,343		probably null	Het
Ranbp2	T	C	10: 58,493,898	I3031T	probably damaging	Het
Rnf219	T	C	14: 104,479,527	Y470C	probably damaging	Het
Sbno1	T	C	5: 124,384,541	D1072G	probably damaging	Het
Senp7	A	G	16: 56,123,873	T187A	possibly damaging	Het
Serpinh1	A	G	7: 99,349,394	C10R	unknown	Het
Sh2d4a	A	G	8: 68,346,694	Y405C	possibly damaging	Het
Slc26a7	T	C	4: 14,621,317	D23G	probably benign	Het
Slc7a7	A	G	14: 54,377,802	L246P	probably damaging	Het
Spire1	T	C	18: 67,528,875	R163G	probably damaging	Het
Stxbp2	T	A	8: 3,632,559	D49E	probably damaging	Het
Susd2	C	T	10: 75,638,235	A509T	probably benign	Het
Sycp2	A	G	2: 178,382,404	F396L	probably damaging	Het
Syne2	T	C	12: 75,963,813	L2499P	probably damaging	Het
Syt10	C	A	15: 89,826,941	A130S	probably benign	Het
Sytl4	A	T	X: 133,962,187	D16E	probably benign	Het
Tab2	C	T	10: 7,920,119	V126I	probably damaging	Het
Tecpr1	T	C	5: 144,211,499	T363A	probably damaging	Het
Terb2	A	G	2: 122,186,335	D16G	probably benign	Het
Tm2d2	A	G	8: 25,020,536	E137G	probably benign	Het
Trim30d	T	A	7: 104,472,485	H201L	probably damaging	Het
Tspan3	A	G	9: 56,147,385		probably null	Het
Ttn	A	T	2: 76,787,323	L16268Q	probably damaging	Het
Ttn	A	T	2: 76,796,185		probably null	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Zeb2	A	T	2: 44,996,126	M973K	possibly damaging	Het
Zfp229	A	G	17: 21,746,634	E615G	probably damaging	Het
Zfp655	T	A	5: 145,244,057	S242T	possibly damaging	Het
Zfp788	T	A	7: 41,648,281	F62I	possibly damaging	Het
Zmynd8	A	G	2: 165,787,158		probably null	Het

Other mutations in Ubap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Ubap2	APN	4	41195328	splice site	probably benign
IGL01109:Ubap2	APN	4	41195155	missense	probably damaging	1.00
IGL01354:Ubap2	APN	4	41207005	missense	probably damaging	1.00
IGL01563:Ubap2	APN	4	41195998	missense	probably damaging	0.96
IGL01602:Ubap2	APN	4	41227237	missense	probably damaging	1.00
IGL01605:Ubap2	APN	4	41227237	missense	probably damaging	1.00
IGL01688:Ubap2	APN	4	41226308	missense	probably benign
IGL01733:Ubap2	APN	4	41195862	unclassified	probably benign
IGL01896:Ubap2	APN	4	41202362	missense	possibly damaging	0.85
IGL01942:Ubap2	APN	4	41251608	missense	probably benign	0.00
IGL02095:Ubap2	APN	4	41229709	missense	probably benign
R0938:Ubap2	UTSW	4	41202304	missense	probably damaging	1.00
R1449:Ubap2	UTSW	4	41209351	critical splice donor site	probably null
R1484:Ubap2	UTSW	4	41235593	missense	probably damaging	1.00
R1548:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1549:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1604:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1607:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1739:Ubap2	UTSW	4	41206849	missense	probably benign	0.00
R1772:Ubap2	UTSW	4	41202380	missense	probably benign	0.02
R1862:Ubap2	UTSW	4	41221607	missense	probably benign
R1869:Ubap2	UTSW	4	41233617	missense	probably damaging	1.00
R1886:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1887:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2063:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2064:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2065:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2066:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2095:Ubap2	UTSW	4	41206901	missense	possibly damaging	0.68
R2214:Ubap2	UTSW	4	41199714	critical splice donor site	probably null
R2215:Ubap2	UTSW	4	41196483	splice site	probably null
R2318:Ubap2	UTSW	4	41251542	missense	probably damaging	0.99
R3755:Ubap2	UTSW	4	41195482	missense	probably damaging	1.00
R4620:Ubap2	UTSW	4	41233698	missense	probably damaging	1.00
R4717:Ubap2	UTSW	4	41218333	missense	possibly damaging	0.93
R4756:Ubap2	UTSW	4	41211771	missense	probably damaging	1.00
R4942:Ubap2	UTSW	4	41245461	intron	probably benign
R5344:Ubap2	UTSW	4	41251578	missense	possibly damaging	0.46
R5763:Ubap2	UTSW	4	41195809	missense	probably damaging	1.00
R5851:Ubap2	UTSW	4	41206268	nonsense	probably null
R5951:Ubap2	UTSW	4	41205753	splice site	probably null
R6178:Ubap2	UTSW	4	41206981	missense	probably benign
R6489:Ubap2	UTSW	4	41203574	critical splice acceptor site	probably null
R6520:Ubap2	UTSW	4	41195155	missense	probably damaging	1.00
R6652:Ubap2	UTSW	4	41196743	missense	possibly damaging	0.68
R6702:Ubap2	UTSW	4	41227210	small insertion	probably benign
R6736:Ubap2	UTSW	4	41227210	small insertion	probably benign
R6736:Ubap2	UTSW	4	41227224	small insertion	probably benign
R6860:Ubap2	UTSW	4	41233631	missense	probably damaging	1.00
R7007:Ubap2	UTSW	4	41206221	missense	probably damaging	0.97
R7048:Ubap2	UTSW	4	41196033	missense	possibly damaging	0.49
R7121:Ubap2	UTSW	4	41205550	missense	probably benign	0.00
R7371:Ubap2	UTSW	4	41195779	missense	probably benign	0.16
R7378:Ubap2	UTSW	4	41235515	critical splice donor site	probably null
R7695:Ubap2	UTSW	4	41211740	missense	probably damaging	0.98
R7811:Ubap2	UTSW	4	41211710	missense	probably benign	0.22
R7828:Ubap2	UTSW	4	41221615	missense	probably benign	0.00
R7838:Ubap2	UTSW	4	41233655	missense	probably damaging	1.00
R8016:Ubap2	UTSW	4	41195201	missense	possibly damaging	0.91
R8790:Ubap2	UTSW	4	41209351	critical splice donor site	probably null
R8817:Ubap2	UTSW	4	41223425	missense	possibly damaging	0.66
R9379:Ubap2	UTSW	4	41216630	missense	possibly damaging	0.67
R9470:Ubap2	UTSW	4	41195434	missense	possibly damaging	0.64
R9536:Ubap2	UTSW	4	41195661	missense	probably benign	0.01
X0061:Ubap2	UTSW	4	41196507	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCAACTACTTGAGAAGCAAGAGACAGA -3'
(R):5'- TGGCAATGCCAGAAATTGAGCCAT -3'

Sequencing Primer
(F):5'- CAAGAGACAGAAGCCAAAAGAAC -3'
(R):5'- tgtttttgtttgtttggtttgttttg -3'

Posted On

2013-07-11