Incidental Mutation 'R6992:Cyp2b9'
ID543903
Institutional Source Beutler Lab
Gene Symbol Cyp2b9
Ensembl Gene ENSMUSG00000040660
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 9
Synonyms16\alphaoh-a, phenobarbitol inducible, type a, Cyp2b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6992 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location26173411-26210661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26201139 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 401 (Y401H)
Ref Sequence ENSEMBL: ENSMUSP00000080846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082214]
Predicted Effect probably benign
Transcript: ENSMUST00000082214
AA Change: Y401H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080846
Gene: ENSMUSG00000040660
AA Change: Y401H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:p450 31 488 1.7e-146 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T C 9: 92,354,672 M128T probably benign Het
4921539E11Rik C T 4: 103,242,793 S171N possibly damaging Het
6030468B19Rik T G 11: 117,797,768 M1R probably null Het
9530053A07Rik T A 7: 28,140,183 F474I probably benign Het
A730049H05Rik T C 6: 92,827,994 probably benign Het
AC125199.3 G T 16: 88,812,027 H52Q possibly damaging Het
Adam34 A T 8: 43,652,605 M1K probably null Het
Adgrf5 T C 17: 43,452,323 probably null Het
Antxr2 T C 5: 97,960,705 T316A probably benign Het
Cc2d1a A T 8: 84,134,913 V714D probably damaging Het
Cd96 A G 16: 46,049,724 S461P possibly damaging Het
Cdc16 C A 8: 13,759,188 A51E probably benign Het
Chd4 T A 6: 125,114,376 D1243E probably benign Het
Cntf A T 19: 12,765,333 I21N probably damaging Het
Col11a2 C T 17: 34,047,144 A282V probably benign Het
Col14a1 T A 15: 55,411,562 probably null Het
Dlgap4 A G 2: 156,748,940 probably null Het
Fancd2 T C 6: 113,571,018 probably null Het
Frem1 A G 4: 82,940,362 V1622A possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Gstm4 A G 3: 108,044,665 M3T possibly damaging Het
Hdac10 T C 15: 89,125,331 D466G probably benign Het
Hook2 A G 8: 85,002,556 E625G probably damaging Het
Hspbp1 G C 7: 4,664,715 P260A probably benign Het
Igdcc3 C A 9: 65,181,571 Q411K probably damaging Het
Il18rap G A 1: 40,542,035 E356K probably benign Het
Inpp4a A T 1: 37,389,691 M699L probably damaging Het
Klhdc1 A G 12: 69,253,757 H157R probably damaging Het
Klhl6 G T 16: 19,953,587 T336N probably damaging Het
March7 T C 2: 60,229,084 probably null Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlh3 T A 12: 85,235,720 N1412Y probably damaging Het
Mrps27 A G 13: 99,405,014 M209V probably benign Het
Mtor A T 4: 148,464,475 T572S probably benign Het
Neurog1 T C 13: 56,251,550 K128R probably damaging Het
Olfr124 T A 17: 37,805,863 N239K probably damaging Het
Olfr1484 A G 19: 13,585,447 I48V possibly damaging Het
Olfr981 T A 9: 40,022,600 L69* probably null Het
Pcdhgb1 A G 18: 37,681,599 K381R probably benign Het
Pdzd2 T C 15: 12,457,859 D306G probably damaging Het
Plekha5 C T 6: 140,543,908 T237I probably damaging Het
Pole A T 5: 110,332,499 I103F probably damaging Het
Ppfia2 A T 10: 106,474,854 Q74L possibly damaging Het
Ppm1d T C 11: 85,332,352 F261S probably damaging Het
Psg21 A T 7: 18,654,743 probably null Het
Ptprg T A 14: 11,962,602 F133L probably damaging Het
Rom1 G A 19: 8,929,205 probably benign Het
Rtn3 A G 19: 7,435,124 F762L probably damaging Het
Sec23ip T C 7: 128,765,440 S600P probably benign Het
Sema4b T A 7: 80,220,152 I396N probably damaging Het
Serpina3k T A 12: 104,341,107 D199E probably benign Het
Slc19a1 A G 10: 77,049,706 D480G possibly damaging Het
Slc8b1 G A 5: 120,527,815 V404M probably damaging Het
Slco1a4 T C 6: 141,819,604 D304G probably benign Het
Smpdl3b G T 4: 132,745,141 A107D possibly damaging Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Tmem245 A G 4: 56,937,940 F203L probably benign Het
Tnip1 T A 11: 54,918,716 I442F probably benign Het
Txnip A G 3: 96,559,123 K127R possibly damaging Het
Usp32 A C 11: 85,032,088 L172R probably damaging Het
Vmn2r66 A G 7: 85,005,228 S508P possibly damaging Het
Vwa5b2 T A 16: 20,598,202 Y550N probably damaging Het
Wdr81 G A 11: 75,451,786 A885V probably benign Het
Other mutations in Cyp2b9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cyp2b9 APN 7 26198505 missense probably damaging 0.99
IGL01133:Cyp2b9 APN 7 26210235 missense probably damaging 1.00
IGL01331:Cyp2b9 APN 7 26187715 missense probably damaging 0.99
IGL02281:Cyp2b9 APN 7 26201104 missense probably damaging 0.99
IGL02502:Cyp2b9 APN 7 26187814 critical splice donor site probably null
IGL02713:Cyp2b9 APN 7 26173520 missense probably benign 0.12
IGL03032:Cyp2b9 APN 7 26198600 splice site probably benign
IGL03307:Cyp2b9 APN 7 26199051 missense probably benign 0.00
R0010:Cyp2b9 UTSW 7 26186753 splice site probably benign
R0025:Cyp2b9 UTSW 7 26200813 missense probably benign 0.09
R0040:Cyp2b9 UTSW 7 26173474 missense possibly damaging 0.68
R0184:Cyp2b9 UTSW 7 26187007 nonsense probably null
R0370:Cyp2b9 UTSW 7 26210106 missense probably damaging 1.00
R1595:Cyp2b9 UTSW 7 26200907 missense possibly damaging 0.72
R1751:Cyp2b9 UTSW 7 26186675 missense probably benign 0.05
R1835:Cyp2b9 UTSW 7 26200783 missense probably benign
R1879:Cyp2b9 UTSW 7 26198569 missense probably damaging 0.99
R2256:Cyp2b9 UTSW 7 26173605 critical splice donor site probably null
R2257:Cyp2b9 UTSW 7 26173605 critical splice donor site probably null
R2418:Cyp2b9 UTSW 7 26186707 missense probably benign 0.00
R3420:Cyp2b9 UTSW 7 26210103 missense probably damaging 1.00
R4088:Cyp2b9 UTSW 7 26173456 missense probably damaging 0.99
R4412:Cyp2b9 UTSW 7 26198443 missense probably damaging 1.00
R4495:Cyp2b9 UTSW 7 26200755 missense probably benign 0.00
R4615:Cyp2b9 UTSW 7 26201125 missense probably damaging 1.00
R5375:Cyp2b9 UTSW 7 26187742 missense probably damaging 1.00
R5426:Cyp2b9 UTSW 7 26187655 missense probably benign
R5862:Cyp2b9 UTSW 7 26187807 missense probably benign 0.01
R6237:Cyp2b9 UTSW 7 26173574 missense probably benign 0.02
R6445:Cyp2b9 UTSW 7 26186987 missense probably benign 0.13
R7515:Cyp2b9 UTSW 7 26199171 missense probably damaging 1.00
R7654:Cyp2b9 UTSW 7 26186942 missense possibly damaging 0.72
R7816:Cyp2b9 UTSW 7 26201092 missense probably benign 0.01
R7850:Cyp2b9 UTSW 7 26186686 nonsense probably null
R7933:Cyp2b9 UTSW 7 26186686 nonsense probably null
Z1177:Cyp2b9 UTSW 7 26201163 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ACTACTCCATGAGCACACTATG -3'
(R):5'- GATTGTTCAGCAAGGCAGCTAG -3'

Sequencing Primer
(F):5'- GCTTCTAATCACCAAGCTCATCTGG -3'
(R):5'- TCAGTAAACAGGGACCTATTGCTG -3'
Posted On2019-05-13