Incidental Mutation 'R6992:Cyp2b9'
ID 543903
Institutional Source Beutler Lab
Gene Symbol Cyp2b9
Ensembl Gene ENSMUSG00000040660
Gene Name cytochrome P450, family 2, subfamily b, polypeptide 9
Synonyms phenobarbitol inducible, type a, Cyp2b
MMRRC Submission 045098-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R6992 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 25872836-25910086 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25900564 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 401 (Y401H)
Ref Sequence ENSEMBL: ENSMUSP00000080846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082214]
AlphaFold P12790
Predicted Effect probably benign
Transcript: ENSMUST00000082214
AA Change: Y401H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080846
Gene: ENSMUSG00000040660
AA Change: Y401H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:p450 31 488 1.7e-146 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,099,990 (GRCm39) S171N possibly damaging Het
6030468B19Rik T G 11: 117,688,594 (GRCm39) M1R probably null Het
A730049H05Rik T C 6: 92,804,975 (GRCm39) probably benign Het
AC125199.3 G T 16: 88,608,915 (GRCm39) H52Q possibly damaging Het
Adam34 A T 8: 44,105,642 (GRCm39) M1K probably null Het
Adgrf5 T C 17: 43,763,214 (GRCm39) probably null Het
Antxr2 T C 5: 98,108,564 (GRCm39) T316A probably benign Het
Cc2d1a A T 8: 84,861,542 (GRCm39) V714D probably damaging Het
Cd96 A G 16: 45,870,087 (GRCm39) S461P possibly damaging Het
Cdc16 C A 8: 13,809,188 (GRCm39) A51E probably benign Het
Chd4 T A 6: 125,091,339 (GRCm39) D1243E probably benign Het
Cntf A T 19: 12,742,697 (GRCm39) I21N probably damaging Het
Col11a2 C T 17: 34,266,118 (GRCm39) A282V probably benign Het
Col14a1 T A 15: 55,274,958 (GRCm39) probably null Het
Dlgap4 A G 2: 156,590,860 (GRCm39) probably null Het
Fancd2 T C 6: 113,547,979 (GRCm39) probably null Het
Fcgbpl1 T A 7: 27,839,608 (GRCm39) F474I probably benign Het
Frem1 A G 4: 82,858,599 (GRCm39) V1622A possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,797,390 (GRCm39) probably benign Het
Gstm4 A G 3: 107,951,981 (GRCm39) M3T possibly damaging Het
Hdac10 T C 15: 89,009,534 (GRCm39) D466G probably benign Het
Hook2 A G 8: 85,729,185 (GRCm39) E625G probably damaging Het
Hspbp1 G C 7: 4,667,714 (GRCm39) P260A probably benign Het
Igdcc3 C A 9: 65,088,853 (GRCm39) Q411K probably damaging Het
Il18rap G A 1: 40,581,195 (GRCm39) E356K probably benign Het
Inpp4a A T 1: 37,428,772 (GRCm39) M699L probably damaging Het
Klhdc1 A G 12: 69,300,531 (GRCm39) H157R probably damaging Het
Klhl6 G T 16: 19,772,337 (GRCm39) T336N probably damaging Het
Marchf7 T C 2: 60,059,428 (GRCm39) probably null Het
Mast4 C T 13: 102,941,155 (GRCm39) V301I probably damaging Het
Mlh3 T A 12: 85,282,494 (GRCm39) N1412Y probably damaging Het
Mrps27 A G 13: 99,541,522 (GRCm39) M209V probably benign Het
Mtor A T 4: 148,548,932 (GRCm39) T572S probably benign Het
Neurog1 T C 13: 56,399,363 (GRCm39) K128R probably damaging Het
Or10g6 T A 9: 39,933,896 (GRCm39) L69* probably null Het
Or2b4 T A 17: 38,116,754 (GRCm39) N239K probably damaging Het
Or5b122 A G 19: 13,562,811 (GRCm39) I48V possibly damaging Het
Pcdhgb1 A G 18: 37,814,652 (GRCm39) K381R probably benign Het
Pdzd2 T C 15: 12,457,945 (GRCm39) D306G probably damaging Het
Plekha5 C T 6: 140,489,634 (GRCm39) T237I probably damaging Het
Plscr1l1 T C 9: 92,236,725 (GRCm39) M128T probably benign Het
Pole A T 5: 110,480,365 (GRCm39) I103F probably damaging Het
Ppfia2 A T 10: 106,310,715 (GRCm39) Q74L possibly damaging Het
Ppm1d T C 11: 85,223,178 (GRCm39) F261S probably damaging Het
Psg21 A T 7: 18,388,668 (GRCm39) probably null Het
Ptprg T A 14: 11,962,602 (GRCm38) F133L probably damaging Het
Rom1 G A 19: 8,906,569 (GRCm39) probably benign Het
Rtn3 A G 19: 7,412,489 (GRCm39) F762L probably damaging Het
Sec23ip T C 7: 128,367,164 (GRCm39) S600P probably benign Het
Sema4b T A 7: 79,869,900 (GRCm39) I396N probably damaging Het
Serpina3k T A 12: 104,307,366 (GRCm39) D199E probably benign Het
Slc19a1 A G 10: 76,885,540 (GRCm39) D480G possibly damaging Het
Slc8b1 G A 5: 120,665,880 (GRCm39) V404M probably damaging Het
Slco1a4 T C 6: 141,765,330 (GRCm39) D304G probably benign Het
Smpdl3b G T 4: 132,472,452 (GRCm39) A107D possibly damaging Het
Tesk1 A G 4: 43,447,006 (GRCm39) T465A probably benign Het
Tmem245 A G 4: 56,937,940 (GRCm39) F203L probably benign Het
Tnip1 T A 11: 54,809,542 (GRCm39) I442F probably benign Het
Txnip A G 3: 96,466,439 (GRCm39) K127R possibly damaging Het
Usp32 A C 11: 84,922,914 (GRCm39) L172R probably damaging Het
Vmn2r66 A G 7: 84,654,436 (GRCm39) S508P possibly damaging Het
Vwa5b2 T A 16: 20,416,952 (GRCm39) Y550N probably damaging Het
Wdr81 G A 11: 75,342,612 (GRCm39) A885V probably benign Het
Other mutations in Cyp2b9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cyp2b9 APN 7 25,897,930 (GRCm39) missense probably damaging 0.99
IGL01133:Cyp2b9 APN 7 25,909,660 (GRCm39) missense probably damaging 1.00
IGL01331:Cyp2b9 APN 7 25,887,140 (GRCm39) missense probably damaging 0.99
IGL02281:Cyp2b9 APN 7 25,900,529 (GRCm39) missense probably damaging 0.99
IGL02502:Cyp2b9 APN 7 25,887,239 (GRCm39) critical splice donor site probably null
IGL02713:Cyp2b9 APN 7 25,872,945 (GRCm39) missense probably benign 0.12
IGL03032:Cyp2b9 APN 7 25,898,025 (GRCm39) splice site probably benign
IGL03307:Cyp2b9 APN 7 25,898,476 (GRCm39) missense probably benign 0.00
R0010:Cyp2b9 UTSW 7 25,886,178 (GRCm39) splice site probably benign
R0025:Cyp2b9 UTSW 7 25,900,238 (GRCm39) missense probably benign 0.09
R0040:Cyp2b9 UTSW 7 25,872,899 (GRCm39) missense possibly damaging 0.68
R0184:Cyp2b9 UTSW 7 25,886,432 (GRCm39) nonsense probably null
R0370:Cyp2b9 UTSW 7 25,909,531 (GRCm39) missense probably damaging 1.00
R1595:Cyp2b9 UTSW 7 25,900,332 (GRCm39) missense possibly damaging 0.72
R1751:Cyp2b9 UTSW 7 25,886,100 (GRCm39) missense probably benign 0.05
R1835:Cyp2b9 UTSW 7 25,900,208 (GRCm39) missense probably benign
R1879:Cyp2b9 UTSW 7 25,897,994 (GRCm39) missense probably damaging 0.99
R2256:Cyp2b9 UTSW 7 25,873,030 (GRCm39) critical splice donor site probably null
R2257:Cyp2b9 UTSW 7 25,873,030 (GRCm39) critical splice donor site probably null
R2418:Cyp2b9 UTSW 7 25,886,132 (GRCm39) missense probably benign 0.00
R3420:Cyp2b9 UTSW 7 25,909,528 (GRCm39) missense probably damaging 1.00
R4088:Cyp2b9 UTSW 7 25,872,881 (GRCm39) missense probably damaging 0.99
R4412:Cyp2b9 UTSW 7 25,897,868 (GRCm39) missense probably damaging 1.00
R4495:Cyp2b9 UTSW 7 25,900,180 (GRCm39) missense probably benign 0.00
R4615:Cyp2b9 UTSW 7 25,900,550 (GRCm39) missense probably damaging 1.00
R5375:Cyp2b9 UTSW 7 25,887,167 (GRCm39) missense probably damaging 1.00
R5426:Cyp2b9 UTSW 7 25,887,080 (GRCm39) missense probably benign
R5862:Cyp2b9 UTSW 7 25,887,232 (GRCm39) missense probably benign 0.01
R6237:Cyp2b9 UTSW 7 25,872,999 (GRCm39) missense probably benign 0.02
R6445:Cyp2b9 UTSW 7 25,886,412 (GRCm39) missense probably benign 0.13
R7515:Cyp2b9 UTSW 7 25,898,596 (GRCm39) missense probably damaging 1.00
R7654:Cyp2b9 UTSW 7 25,886,367 (GRCm39) missense possibly damaging 0.72
R7816:Cyp2b9 UTSW 7 25,900,517 (GRCm39) missense probably benign 0.01
R7850:Cyp2b9 UTSW 7 25,886,111 (GRCm39) nonsense probably null
R8734:Cyp2b9 UTSW 7 25,898,035 (GRCm39) intron probably benign
R8790:Cyp2b9 UTSW 7 25,898,167 (GRCm39) intron probably benign
R8839:Cyp2b9 UTSW 7 25,900,185 (GRCm39) missense probably damaging 0.96
R9209:Cyp2b9 UTSW 7 25,873,004 (GRCm39) missense possibly damaging 0.52
R9723:Cyp2b9 UTSW 7 25,909,596 (GRCm39) nonsense probably null
R9787:Cyp2b9 UTSW 7 25,900,259 (GRCm39) missense probably benign 0.04
Z1177:Cyp2b9 UTSW 7 25,900,588 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ACTACTCCATGAGCACACTATG -3'
(R):5'- GATTGTTCAGCAAGGCAGCTAG -3'

Sequencing Primer
(F):5'- GCTTCTAATCACCAAGCTCATCTGG -3'
(R):5'- TCAGTAAACAGGGACCTATTGCTG -3'
Posted On 2019-05-13