Incidental Mutation 'R6992:9530053A07Rik'
ID 543904
Institutional Source Beutler Lab
Gene Symbol 9530053A07Rik
Ensembl Gene ENSMUSG00000078776
Gene Name RIKEN cDNA 9530053A07 gene
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R6992 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 28129466-28164811 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28140183 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 474 (F474I)
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
AlphaFold E9PVG8
Predicted Effect probably benign
Transcript: ENSMUST00000059886
AA Change: F474I

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: F474I

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150948
AA Change: F474I

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: F474I

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T C 9: 92,354,672 M128T probably benign Het
4921539E11Rik C T 4: 103,242,793 S171N possibly damaging Het
6030468B19Rik T G 11: 117,797,768 M1R probably null Het
A730049H05Rik T C 6: 92,827,994 probably benign Het
AC125199.3 G T 16: 88,812,027 H52Q possibly damaging Het
Adam34 A T 8: 43,652,605 M1K probably null Het
Adgrf5 T C 17: 43,452,323 probably null Het
Antxr2 T C 5: 97,960,705 T316A probably benign Het
Cc2d1a A T 8: 84,134,913 V714D probably damaging Het
Cd96 A G 16: 46,049,724 S461P possibly damaging Het
Cdc16 C A 8: 13,759,188 A51E probably benign Het
Chd4 T A 6: 125,114,376 D1243E probably benign Het
Cntf A T 19: 12,765,333 I21N probably damaging Het
Col11a2 C T 17: 34,047,144 A282V probably benign Het
Col14a1 T A 15: 55,411,562 probably null Het
Cyp2b9 T C 7: 26,201,139 Y401H probably benign Het
Dlgap4 A G 2: 156,748,940 probably null Het
Fancd2 T C 6: 113,571,018 probably null Het
Frem1 A G 4: 82,940,362 V1622A possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Gstm4 A G 3: 108,044,665 M3T possibly damaging Het
Hdac10 T C 15: 89,125,331 D466G probably benign Het
Hook2 A G 8: 85,002,556 E625G probably damaging Het
Hspbp1 G C 7: 4,664,715 P260A probably benign Het
Igdcc3 C A 9: 65,181,571 Q411K probably damaging Het
Il18rap G A 1: 40,542,035 E356K probably benign Het
Inpp4a A T 1: 37,389,691 M699L probably damaging Het
Klhdc1 A G 12: 69,253,757 H157R probably damaging Het
Klhl6 G T 16: 19,953,587 T336N probably damaging Het
March7 T C 2: 60,229,084 probably null Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlh3 T A 12: 85,235,720 N1412Y probably damaging Het
Mrps27 A G 13: 99,405,014 M209V probably benign Het
Mtor A T 4: 148,464,475 T572S probably benign Het
Neurog1 T C 13: 56,251,550 K128R probably damaging Het
Olfr124 T A 17: 37,805,863 N239K probably damaging Het
Olfr1484 A G 19: 13,585,447 I48V possibly damaging Het
Olfr981 T A 9: 40,022,600 L69* probably null Het
Pcdhgb1 A G 18: 37,681,599 K381R probably benign Het
Pdzd2 T C 15: 12,457,859 D306G probably damaging Het
Plekha5 C T 6: 140,543,908 T237I probably damaging Het
Pole A T 5: 110,332,499 I103F probably damaging Het
Ppfia2 A T 10: 106,474,854 Q74L possibly damaging Het
Ppm1d T C 11: 85,332,352 F261S probably damaging Het
Psg21 A T 7: 18,654,743 probably null Het
Ptprg T A 14: 11,962,602 F133L probably damaging Het
Rom1 G A 19: 8,929,205 probably benign Het
Rtn3 A G 19: 7,435,124 F762L probably damaging Het
Sec23ip T C 7: 128,765,440 S600P probably benign Het
Sema4b T A 7: 80,220,152 I396N probably damaging Het
Serpina3k T A 12: 104,341,107 D199E probably benign Het
Slc19a1 A G 10: 77,049,706 D480G possibly damaging Het
Slc8b1 G A 5: 120,527,815 V404M probably damaging Het
Slco1a4 T C 6: 141,819,604 D304G probably benign Het
Smpdl3b G T 4: 132,745,141 A107D possibly damaging Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Tmem245 A G 4: 56,937,940 F203L probably benign Het
Tnip1 T A 11: 54,918,716 I442F probably benign Het
Txnip A G 3: 96,559,123 K127R possibly damaging Het
Usp32 A C 11: 85,032,088 L172R probably damaging Het
Vmn2r66 A G 7: 85,005,228 S508P possibly damaging Het
Vwa5b2 T A 16: 20,598,202 Y550N probably damaging Het
Wdr81 G A 11: 75,451,786 A885V probably benign Het
Other mutations in 9530053A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:9530053A07Rik APN 7 28164528 missense probably damaging 1.00
IGL00757:9530053A07Rik APN 7 28154445 missense probably damaging 1.00
IGL01015:9530053A07Rik APN 7 28155318 missense probably damaging 1.00
IGL01079:9530053A07Rik APN 7 28139778 missense probably damaging 0.99
IGL01343:9530053A07Rik APN 7 28150702 missense probably benign 0.19
IGL01420:9530053A07Rik APN 7 28140133 missense probably benign 0.28
IGL01604:9530053A07Rik APN 7 28155324 missense probably benign 0.11
IGL01666:9530053A07Rik APN 7 28153292 missense probably damaging 1.00
IGL02002:9530053A07Rik APN 7 28152796 missense probably damaging 1.00
IGL02036:9530053A07Rik APN 7 28137525 missense possibly damaging 0.82
IGL02126:9530053A07Rik APN 7 28139856 missense probably damaging 1.00
IGL02150:9530053A07Rik APN 7 28146779 nonsense probably null
IGL02219:9530053A07Rik APN 7 28154635 missense probably damaging 1.00
IGL02563:9530053A07Rik APN 7 28157892 missense probably benign
IGL02804:9530053A07Rik APN 7 28153370 missense probably benign 0.00
IGL02830:9530053A07Rik APN 7 28162923 missense probably damaging 1.00
IGL02943:9530053A07Rik APN 7 28147188 missense probably damaging 1.00
IGL02977:9530053A07Rik APN 7 28164372 missense possibly damaging 0.83
IGL03231:9530053A07Rik APN 7 28153722 missense possibly damaging 0.95
IGL03304:9530053A07Rik APN 7 28142242 missense probably damaging 0.99
herz UTSW 7 28153839 missense possibly damaging 0.72
pulse UTSW 7 28153749 missense probably damaging 1.00
Sinusoidal UTSW 7 28140130 missense probably damaging 1.00
PIT4378001:9530053A07Rik UTSW 7 28154464 missense possibly damaging 0.61
R0023:9530053A07Rik UTSW 7 28153412 missense probably benign 0.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0132:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0158:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R0230:9530053A07Rik UTSW 7 28156825 missense probably damaging 1.00
R0310:9530053A07Rik UTSW 7 28142274 missense probably benign 0.04
R0448:9530053A07Rik UTSW 7 28140235 missense probably benign 0.03
R0462:9530053A07Rik UTSW 7 28137340 missense probably damaging 1.00
R0481:9530053A07Rik UTSW 7 28153749 missense probably damaging 1.00
R0497:9530053A07Rik UTSW 7 28147465 missense probably damaging 1.00
R0556:9530053A07Rik UTSW 7 28159378 missense probably benign
R0562:9530053A07Rik UTSW 7 28162690 missense probably benign 0.30
R0586:9530053A07Rik UTSW 7 28137091 missense probably damaging 0.99
R0924:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R0930:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R1103:9530053A07Rik UTSW 7 28154520 missense probably damaging 1.00
R1213:9530053A07Rik UTSW 7 28157673 missense probably damaging 1.00
R1292:9530053A07Rik UTSW 7 28142794 splice site probably benign
R1368:9530053A07Rik UTSW 7 28159478 missense possibly damaging 0.89
R1451:9530053A07Rik UTSW 7 28137157 missense probably damaging 1.00
R1477:9530053A07Rik UTSW 7 28157093 missense probably benign 0.01
R1538:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R1655:9530053A07Rik UTSW 7 28147110 missense probably damaging 0.98
R1697:9530053A07Rik UTSW 7 28154347 missense probably damaging 1.00
R1741:9530053A07Rik UTSW 7 28157854 missense probably damaging 0.98
R1796:9530053A07Rik UTSW 7 28155372 missense probably damaging 1.00
R1853:9530053A07Rik UTSW 7 28155546 nonsense probably null
R1861:9530053A07Rik UTSW 7 28154732 missense probably damaging 1.00
R1909:9530053A07Rik UTSW 7 28144348 missense possibly damaging 0.52
R1971:9530053A07Rik UTSW 7 28131512 missense possibly damaging 0.90
R1990:9530053A07Rik UTSW 7 28154360 missense probably damaging 0.98
R2020:9530053A07Rik UTSW 7 28155594 missense probably benign
R2084:9530053A07Rik UTSW 7 28157535 missense probably damaging 1.00
R2125:9530053A07Rik UTSW 7 28158022 missense probably benign 0.00
R2132:9530053A07Rik UTSW 7 28155474 missense probably damaging 1.00
R2513:9530053A07Rik UTSW 7 28131635 missense probably damaging 0.99
R2913:9530053A07Rik UTSW 7 28164307 missense probably damaging 1.00
R3150:9530053A07Rik UTSW 7 28154195 missense probably benign 0.21
R3499:9530053A07Rik UTSW 7 28154555 missense probably benign 0.42
R3702:9530053A07Rik UTSW 7 28157778 missense probably damaging 1.00
R3881:9530053A07Rik UTSW 7 28140038 nonsense probably null
R3938:9530053A07Rik UTSW 7 28154294 missense probably damaging 1.00
R4050:9530053A07Rik UTSW 7 28152985 missense possibly damaging 0.55
R4152:9530053A07Rik UTSW 7 28156897 missense possibly damaging 0.47
R4168:9530053A07Rik UTSW 7 28137109 missense probably benign 0.05
R4235:9530053A07Rik UTSW 7 28156648 missense probably damaging 0.99
R4241:9530053A07Rik UTSW 7 28154335 missense probably damaging 1.00
R4363:9530053A07Rik UTSW 7 28146906 missense probably damaging 1.00
R4460:9530053A07Rik UTSW 7 28152856 missense probably benign 0.17
R4463:9530053A07Rik UTSW 7 28150719 missense probably benign
R4841:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4842:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4876:9530053A07Rik UTSW 7 28142800 intron probably benign
R4905:9530053A07Rik UTSW 7 28156983 missense possibly damaging 0.93
R4997:9530053A07Rik UTSW 7 28143924 missense possibly damaging 0.77
R5091:9530053A07Rik UTSW 7 28156958 missense probably benign 0.44
R5159:9530053A07Rik UTSW 7 28153308 missense probably benign 0.09
R5326:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5396:9530053A07Rik UTSW 7 28140183 missense probably benign
R5441:9530053A07Rik UTSW 7 28156914 missense probably damaging 1.00
R5480:9530053A07Rik UTSW 7 28157999 nonsense probably null
R5542:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5571:9530053A07Rik UTSW 7 28156569 missense probably damaging 0.99
R5613:9530053A07Rik UTSW 7 28142878 intron probably benign
R5637:9530053A07Rik UTSW 7 28152852 missense probably benign 0.00
R5766:9530053A07Rik UTSW 7 28137329 nonsense probably null
R6174:9530053A07Rik UTSW 7 28139959 missense probably damaging 0.96
R6233:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R6250:9530053A07Rik UTSW 7 28150714 missense probably damaging 1.00
R6379:9530053A07Rik UTSW 7 28157592 missense probably damaging 1.00
R6442:9530053A07Rik UTSW 7 28144186 missense possibly damaging 0.88
R6478:9530053A07Rik UTSW 7 28155373 missense probably damaging 1.00
R6699:9530053A07Rik UTSW 7 28144368 missense probably damaging 1.00
R6852:9530053A07Rik UTSW 7 28147135 missense probably damaging 1.00
R6883:9530053A07Rik UTSW 7 28152835 missense possibly damaging 0.89
R6902:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6903:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6904:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R7023:9530053A07Rik UTSW 7 28140038 nonsense probably null
R7039:9530053A07Rik UTSW 7 28140148 missense possibly damaging 0.80
R7171:9530053A07Rik UTSW 7 28154519 nonsense probably null
R7282:9530053A07Rik UTSW 7 28144408 missense probably benign 0.02
R7291:9530053A07Rik UTSW 7 28140220 missense probably benign
R7344:9530053A07Rik UTSW 7 28140279 missense possibly damaging 0.79
R7344:9530053A07Rik UTSW 7 28152760 missense possibly damaging 0.46
R7392:9530053A07Rik UTSW 7 28164372 missense possibly damaging 0.83
R7531:9530053A07Rik UTSW 7 28140231 missense probably benign
R7541:9530053A07Rik UTSW 7 28144256 nonsense probably null
R7577:9530053A07Rik UTSW 7 28154423 missense possibly damaging 0.65
R7594:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R7647:9530053A07Rik UTSW 7 28140045 missense probably benign 0.00
R7718:9530053A07Rik UTSW 7 28147201 missense probably damaging 1.00
R7733:9530053A07Rik UTSW 7 28139965 missense probably damaging 1.00
R7737:9530053A07Rik UTSW 7 28157073 missense probably damaging 1.00
R7908:9530053A07Rik UTSW 7 28147496 missense probably benign 0.12
R8013:9530053A07Rik UTSW 7 28137541 missense probably benign 0.14
R8014:9530053A07Rik UTSW 7 28137541 missense probably benign 0.14
R8151:9530053A07Rik UTSW 7 28153341 missense possibly damaging 0.95
R8175:9530053A07Rik UTSW 7 28164448 nonsense probably null
R8254:9530053A07Rik UTSW 7 28147349 missense possibly damaging 0.63
R8345:9530053A07Rik UTSW 7 28155360 missense probably damaging 1.00
R8414:9530053A07Rik UTSW 7 28142733 missense probably damaging 1.00
R8419:9530053A07Rik UTSW 7 28143921 missense probably damaging 1.00
R8496:9530053A07Rik UTSW 7 28143952 missense possibly damaging 0.81
R8691:9530053A07Rik UTSW 7 28153839 missense possibly damaging 0.72
R8785:9530053A07Rik UTSW 7 28154707 missense probably damaging 1.00
R8863:9530053A07Rik UTSW 7 28131581 missense probably damaging 1.00
R8926:9530053A07Rik UTSW 7 28154444 missense probably damaging 1.00
R8950:9530053A07Rik UTSW 7 28164326 missense probably benign 0.32
R9014:9530053A07Rik UTSW 7 28155451 missense probably damaging 1.00
R9045:9530053A07Rik UTSW 7 28154431 missense probably damaging 1.00
R9115:9530053A07Rik UTSW 7 28154329 missense possibly damaging 0.74
R9233:9530053A07Rik UTSW 7 28140094 missense possibly damaging 0.83
R9330:9530053A07Rik UTSW 7 28156985 missense probably benign 0.02
R9426:9530053A07Rik UTSW 7 28143856 missense possibly damaging 0.92
R9477:9530053A07Rik UTSW 7 28152840 missense probably damaging 1.00
R9502:9530053A07Rik UTSW 7 28137466 missense probably benign 0.09
R9505:9530053A07Rik UTSW 7 28142484 nonsense probably null
R9601:9530053A07Rik UTSW 7 28154380 missense possibly damaging 0.78
R9630:9530053A07Rik UTSW 7 28137199 missense probably damaging 1.00
R9632:9530053A07Rik UTSW 7 28142301 missense probably benign
R9673:9530053A07Rik UTSW 7 28156619 missense probably benign 0.25
R9735:9530053A07Rik UTSW 7 28157010 missense probably damaging 1.00
Z1176:9530053A07Rik UTSW 7 28142386 missense probably benign 0.06
Z1176:9530053A07Rik UTSW 7 28154762 missense probably benign 0.03
Z1177:9530053A07Rik UTSW 7 28139898 missense probably benign 0.25
Z1186:9530053A07Rik UTSW 7 28131572 missense probably benign
Z1186:9530053A07Rik UTSW 7 28146705 missense probably benign 0.00
Z1186:9530053A07Rik UTSW 7 28156986 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCACTCAGAAGGTGATCTG -3'
(R):5'- AGCCACAAGGTCGTTGAATG -3'

Sequencing Primer
(F):5'- CCACTCAGAAGGTGATCTGTAGGAAC -3'
(R):5'- TCCTAAGGCCTCCAACTT -3'
Posted On 2019-05-13