Mutagenetix > Incidental Mutation

Incidental Mutation 'R0608:Enam'

54391

Institutional Source

Beutler Lab

Gene Symbol

Enam

Ensembl Gene

ENSMUSG00000029286

Gene Name

enamelin

Synonyms

abte

MMRRC Submission

038797-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.227) question?

Stock #

R0608 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88487975-88506049 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88493027 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 183 (W183R)

Ref Sequence

ENSEMBL: ENSMUSP00000142854 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]

AlphaFold

O55196

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031222
AA Change: W108R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: W108R

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC
low complexity region	67	114	N/A	INTRINSIC
low complexity region	128	150	N/A	INTRINSIC
low complexity region	159	167	N/A	INTRINSIC
low complexity region	173	187	N/A	INTRINSIC
low complexity region	203	214	N/A	INTRINSIC
Pfam:Enamelin	216	441	5.4e-74	PFAM
Pfam:Enamelin	503	1249	1.9e-303	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000199104
AA Change: W183R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: W183R

Domain	Start	End	E-Value	Type
low complexity region	100	113	N/A	INTRINSIC
low complexity region	142	189	N/A	INTRINSIC
low complexity region	203	225	N/A	INTRINSIC
low complexity region	234	242	N/A	INTRINSIC
low complexity region	248	262	N/A	INTRINSIC
low complexity region	278	289	N/A	INTRINSIC
Pfam:Enamelin	291	510	2.5e-74	PFAM
Pfam:Enamelin	550	1325	N/A	PFAM

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.7%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730017C20Rik	A	G	18: 59,062,459		probably null	Het
Akap11	A	G	14: 78,510,753	V1398A	probably benign	Het
Ampd3	C	A	7: 110,795,790	D315E	probably damaging	Het
Ampd3	T	A	7: 110,795,791	F316I	probably damaging	Het
Arhgef40	A	C	14: 51,996,974	E911D	probably damaging	Het
Atxn2l	A	G	7: 126,501,416		probably null	Het
BC117090	T	C	16: 36,323,024		probably null	Het
Bckdhb	T	G	9: 83,953,736	F98V	probably damaging	Het
Calhm1	C	T	19: 47,143,841	V112I	probably benign	Het
Ccdc28a	G	A	10: 18,224,951	R90C	probably damaging	Het
Cdc40	A	T	10: 40,848,052	Y247N	probably benign	Het
Cds1	G	A	5: 101,814,433	V305M	probably damaging	Het
Cep128	T	G	12: 90,999,535		probably benign	Het
Cep72	A	T	13: 74,038,304	H249Q	probably damaging	Het
Cfap70	A	T	14: 20,448,563	Y19N	probably damaging	Het
Col11a1	T	C	3: 114,218,715		probably benign	Het
Cysltr1	A	G	X: 106,578,655	V75A	possibly damaging	Het
Dnah17	G	T	11: 118,090,749	Y1716*	probably null	Het
Dnm1	T	C	2: 32,335,824	E383G	possibly damaging	Het
Dst	C	A	1: 34,290,356		probably null	Het
Edil3	T	C	13: 89,184,849	S375P	probably damaging	Het
Eme1	A	G	11: 94,650,082	C277R	probably damaging	Het
Fbxl6	C	T	15: 76,536,753	V341M	probably benign	Het
Fgf14	A	G	14: 124,676,603	S39P	probably damaging	Het
Fmo4	C	T	1: 162,803,651	R249H	possibly damaging	Het
Gle1	T	A	2: 29,940,228	D265E	probably benign	Het
Gml2	T	C	15: 74,821,386		probably null	Het
Golgb1	G	T	16: 36,916,330	E1980*	probably null	Het
Hap1	A	G	11: 100,349,305	L555P	probably damaging	Het
Heca	T	C	10: 17,915,291	D339G	possibly damaging	Het
Hepacam2	T	C	6: 3,483,479	T101A	possibly damaging	Het
Ift88	T	C	14: 57,496,221	V707A	probably benign	Het
Kdm3a	C	T	6: 71,620,046	G252D	probably benign	Het
Klhl11	A	G	11: 100,472,242	Y163H	probably damaging	Het
Kntc1	A	T	5: 123,786,074	N1008Y	probably damaging	Het
Lrp2	G	T	2: 69,486,243	N2131K	probably benign	Het
Lrrc6	T	A	15: 66,380,474	M448L	probably benign	Het
Magi3	C	G	3: 104,017,557	G1092A	probably damaging	Het
Mef2a	G	T	7: 67,235,148	S406*	probably null	Het
Mrps26	G	T	2: 130,563,858	R27L	possibly damaging	Het
Myof	T	C	19: 37,916,504	D1624G	probably damaging	Het
Naif1	T	C	2: 32,454,896	M204T	probably benign	Het
Ndufb8	T	C	19: 44,550,345	E179G	possibly damaging	Het
Neb	A	T	2: 52,326,757	D135E	probably benign	Het
Nlrp6	C	T	7: 140,923,486	Q502*	probably null	Het
Nploc4	A	G	11: 120,413,681	L238P	probably damaging	Het
Olfr463	G	A	11: 87,893,196	H243Y	probably damaging	Het
Parp4	T	A	14: 56,602,404	V523E	probably damaging	Het
Pdgfra	T	C	5: 75,163,777	Y98H	probably damaging	Het
Plcz1	C	T	6: 139,990,733	R590H	probably damaging	Het
Pnliprp1	T	A	19: 58,738,196	Y328*	probably null	Het
Pnpla8	C	T	12: 44,283,463	P48L	probably benign	Het
Rab44	T	A	17: 29,147,343		probably null	Het
Ranbp2	T	C	10: 58,493,898	I3031T	probably damaging	Het
Rnf219	T	C	14: 104,479,527	Y470C	probably damaging	Het
Sbno1	T	C	5: 124,384,541	D1072G	probably damaging	Het
Senp7	A	G	16: 56,123,873	T187A	possibly damaging	Het
Serpinh1	A	G	7: 99,349,394	C10R	unknown	Het
Sh2d4a	A	G	8: 68,346,694	Y405C	possibly damaging	Het
Slc26a7	T	C	4: 14,621,317	D23G	probably benign	Het
Slc7a7	A	G	14: 54,377,802	L246P	probably damaging	Het
Spire1	T	C	18: 67,528,875	R163G	probably damaging	Het
Stxbp2	T	A	8: 3,632,559	D49E	probably damaging	Het
Susd2	C	T	10: 75,638,235	A509T	probably benign	Het
Sycp2	A	G	2: 178,382,404	F396L	probably damaging	Het
Syne2	T	C	12: 75,963,813	L2499P	probably damaging	Het
Syt10	C	A	15: 89,826,941	A130S	probably benign	Het
Sytl4	A	T	X: 133,962,187	D16E	probably benign	Het
Tab2	C	T	10: 7,920,119	V126I	probably damaging	Het
Tecpr1	T	C	5: 144,211,499	T363A	probably damaging	Het
Terb2	A	G	2: 122,186,335	D16G	probably benign	Het
Tm2d2	A	G	8: 25,020,536	E137G	probably benign	Het
Trim30d	T	A	7: 104,472,485	H201L	probably damaging	Het
Tspan3	A	G	9: 56,147,385		probably null	Het
Ttn	A	T	2: 76,787,323	L16268Q	probably damaging	Het
Ttn	A	T	2: 76,796,185		probably null	Het
Ubap2	T	A	4: 41,218,319	T263S	probably benign	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Zeb2	A	T	2: 44,996,126	M973K	possibly damaging	Het
Zfp229	A	G	17: 21,746,634	E615G	probably damaging	Het
Zfp655	T	A	5: 145,244,057	S242T	possibly damaging	Het
Zfp788	T	A	7: 41,648,281	F62I	possibly damaging	Het
Zmynd8	A	G	2: 165,787,158		probably null	Het

Other mutations in Enam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00769:Enam	APN	5	88501484	missense	possibly damaging	0.83
IGL01611:Enam	APN	5	88503749	missense	probably damaging	0.99
IGL01802:Enam	APN	5	88503674	missense	possibly damaging	0.93
IGL02220:Enam	APN	5	88504559	nonsense	probably null
IGL02371:Enam	APN	5	88502809	missense	probably benign	0.39
IGL02596:Enam	APN	5	88503026	missense	probably benign	0.01
IGL03026:Enam	APN	5	88503299	missense	probably benign	0.38
IGL03303:Enam	APN	5	88504591	missense	probably benign	0.12
opinionated	UTSW	5	88503026	missense	probably benign	0.04
recalcitrant	UTSW	5	88503791	nonsense	probably null
R0200:Enam	UTSW	5	88493027	missense	possibly damaging	0.96
R0230:Enam	UTSW	5	88489655	splice site	probably benign
R0395:Enam	UTSW	5	88501508	missense	probably damaging	0.99
R0548:Enam	UTSW	5	88503105	missense	probably damaging	0.96
R0724:Enam	UTSW	5	88501994	missense	probably damaging	1.00
R0927:Enam	UTSW	5	88494060	missense	possibly damaging	0.72
R1023:Enam	UTSW	5	88501967	missense	probably damaging	0.99
R1053:Enam	UTSW	5	88504019	missense	possibly damaging	0.64
R1169:Enam	UTSW	5	88503258	missense	probably damaging	1.00
R1230:Enam	UTSW	5	88494068	missense	probably damaging	0.99
R1324:Enam	UTSW	5	88494068	missense	possibly damaging	0.53
R1663:Enam	UTSW	5	88503994	missense	probably damaging	1.00
R1727:Enam	UTSW	5	88503994	missense	probably damaging	1.00
R1750:Enam	UTSW	5	88503227	missense	probably damaging	1.00
R1852:Enam	UTSW	5	88504465	missense	possibly damaging	0.92
R1907:Enam	UTSW	5	88504622	missense	possibly damaging	0.86
R2104:Enam	UTSW	5	88501787	missense	probably damaging	1.00
R2143:Enam	UTSW	5	88492920	missense	probably benign	0.02
R2196:Enam	UTSW	5	88502744	missense	probably damaging	0.99
R2363:Enam	UTSW	5	88503149	missense	probably benign	0.24
R2497:Enam	UTSW	5	88502694	missense	probably benign	0.13
R3615:Enam	UTSW	5	88504447	missense	possibly damaging	0.81
R3616:Enam	UTSW	5	88504447	missense	possibly damaging	0.81
R3782:Enam	UTSW	5	88502815	missense	probably damaging	1.00
R4067:Enam	UTSW	5	88503377	missense	probably damaging	1.00
R4349:Enam	UTSW	5	88503548	missense	probably damaging	0.99
R4604:Enam	UTSW	5	88504283	missense	possibly damaging	0.93
R4649:Enam	UTSW	5	88492968	missense	probably benign	0.02
R4702:Enam	UTSW	5	88503791	nonsense	probably null
R4703:Enam	UTSW	5	88503791	nonsense	probably null
R4704:Enam	UTSW	5	88503791	nonsense	probably null
R4705:Enam	UTSW	5	88503791	nonsense	probably null
R4714:Enam	UTSW	5	88503536	missense	probably damaging	1.00
R4748:Enam	UTSW	5	88501543	missense	probably damaging	1.00
R4838:Enam	UTSW	5	88493108	nonsense	probably null
R4840:Enam	UTSW	5	88503026	missense	probably benign	0.04
R4856:Enam	UTSW	5	88488734	nonsense	probably null
R4886:Enam	UTSW	5	88488734	nonsense	probably null
R4910:Enam	UTSW	5	88502314	missense	probably benign
R4911:Enam	UTSW	5	88502314	missense	probably benign
R6103:Enam	UTSW	5	88502328	missense	probably damaging	0.96
R6651:Enam	UTSW	5	88502917	missense	probably damaging	0.98
R6759:Enam	UTSW	5	88501691	missense	probably damaging	1.00
R7282:Enam	UTSW	5	88502327	missense	probably damaging	0.99
R7365:Enam	UTSW	5	88501488	missense	possibly damaging	0.75
R7392:Enam	UTSW	5	88501664	missense	probably damaging	0.99
R7483:Enam	UTSW	5	88501820	missense	probably damaging	1.00
R7647:Enam	UTSW	5	88503025	missense	probably benign	0.00
R7648:Enam	UTSW	5	88504157	missense	possibly damaging	0.89
R7672:Enam	UTSW	5	88503971	missense	possibly damaging	0.80
R7943:Enam	UTSW	5	88488551	splice site	probably null
R7999:Enam	UTSW	5	88503702	missense	probably benign
R8117:Enam	UTSW	5	88503526	missense	probably benign	0.00
R8419:Enam	UTSW	5	88503350	missense	possibly damaging	0.80
R8528:Enam	UTSW	5	88502219	missense	probably damaging	0.98
R8836:Enam	UTSW	5	88491265	critical splice donor site	probably null
R8973:Enam	UTSW	5	88494088	missense	possibly damaging	0.96
R9001:Enam	UTSW	5	88489529	missense	probably benign	0.11
R9033:Enam	UTSW	5	88498616	missense	probably benign	0.01
R9268:Enam	UTSW	5	88492919	missense	probably benign	0.01
R9723:Enam	UTSW	5	88504382	missense	probably damaging	1.00
X0018:Enam	UTSW	5	88502691	nonsense	probably null
Z1176:Enam	UTSW	5	88492971	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGACGAAACTGGACTTCAACCTC -3'
(R):5'- CCTGCCAGGCAACTTTTGATGAATG -3'

Sequencing Primer
(F):5'- GAAACTGGACTTCAACCTCATTCG -3'
(R):5'- TTGGACAGGTGGGGACC -3'

Posted On

2013-07-11