Incidental Mutation 'R6992:Hook2'
ID543911
Institutional Source Beutler Lab
Gene Symbol Hook2
Ensembl Gene ENSMUSG00000052566
Gene Namehook microtubule tethering protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R6992 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location84990603-85003349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85002556 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 625 (E625G)
Ref Sequence ENSEMBL: ENSMUSP00000067752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059072] [ENSMUST00000064495] [ENSMUST00000209322] [ENSMUST00000209421] [ENSMUST00000209764] [ENSMUST00000210326]
Predicted Effect probably benign
Transcript: ENSMUST00000059072
SMART Domains Protein: ENSMUSP00000053408
Gene: ENSMUSG00000052819

DomainStartEndE-ValueType
Pfam:Bestrophin 8 316 5.8e-118 PFAM
low complexity region 340 352 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 428 447 N/A INTRINSIC
low complexity region 457 479 N/A INTRINSIC
low complexity region 484 501 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064495
AA Change: E625G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067752
Gene: ENSMUSG00000052566
AA Change: E625G

DomainStartEndE-ValueType
Pfam:HOOK 8 703 2.3e-277 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209322
Predicted Effect probably benign
Transcript: ENSMUST00000209421
Predicted Effect probably damaging
Transcript: ENSMUST00000209764
AA Change: E601G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000210326
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T C 9: 92,354,672 M128T probably benign Het
4921539E11Rik C T 4: 103,242,793 S171N possibly damaging Het
6030468B19Rik T G 11: 117,797,768 M1R probably null Het
9530053A07Rik T A 7: 28,140,183 F474I probably benign Het
A730049H05Rik T C 6: 92,827,994 probably benign Het
AC125199.3 G T 16: 88,812,027 H52Q possibly damaging Het
Adam34 A T 8: 43,652,605 M1K probably null Het
Adgrf5 T C 17: 43,452,323 probably null Het
Antxr2 T C 5: 97,960,705 T316A probably benign Het
Cc2d1a A T 8: 84,134,913 V714D probably damaging Het
Cd96 A G 16: 46,049,724 S461P possibly damaging Het
Cdc16 C A 8: 13,759,188 A51E probably benign Het
Chd4 T A 6: 125,114,376 D1243E probably benign Het
Cntf A T 19: 12,765,333 I21N probably damaging Het
Col11a2 C T 17: 34,047,144 A282V probably benign Het
Col14a1 T A 15: 55,411,562 probably null Het
Cyp2b9 T C 7: 26,201,139 Y401H probably benign Het
Dlgap4 A G 2: 156,748,940 probably null Het
Fancd2 T C 6: 113,571,018 probably null Het
Frem1 A G 4: 82,940,362 V1622A possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Gstm4 A G 3: 108,044,665 M3T possibly damaging Het
Hdac10 T C 15: 89,125,331 D466G probably benign Het
Hspbp1 G C 7: 4,664,715 P260A probably benign Het
Igdcc3 C A 9: 65,181,571 Q411K probably damaging Het
Il18rap G A 1: 40,542,035 E356K probably benign Het
Inpp4a A T 1: 37,389,691 M699L probably damaging Het
Klhdc1 A G 12: 69,253,757 H157R probably damaging Het
Klhl6 G T 16: 19,953,587 T336N probably damaging Het
March7 T C 2: 60,229,084 probably null Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlh3 T A 12: 85,235,720 N1412Y probably damaging Het
Mrps27 A G 13: 99,405,014 M209V probably benign Het
Mtor A T 4: 148,464,475 T572S probably benign Het
Neurog1 T C 13: 56,251,550 K128R probably damaging Het
Olfr124 T A 17: 37,805,863 N239K probably damaging Het
Olfr1484 A G 19: 13,585,447 I48V possibly damaging Het
Olfr981 T A 9: 40,022,600 L69* probably null Het
Pcdhgb1 A G 18: 37,681,599 K381R probably benign Het
Pdzd2 T C 15: 12,457,859 D306G probably damaging Het
Plekha5 C T 6: 140,543,908 T237I probably damaging Het
Pole A T 5: 110,332,499 I103F probably damaging Het
Ppfia2 A T 10: 106,474,854 Q74L possibly damaging Het
Ppm1d T C 11: 85,332,352 F261S probably damaging Het
Psg21 A T 7: 18,654,743 probably null Het
Ptprg T A 14: 11,962,602 F133L probably damaging Het
Rom1 G A 19: 8,929,205 probably benign Het
Rtn3 A G 19: 7,435,124 F762L probably damaging Het
Sec23ip T C 7: 128,765,440 S600P probably benign Het
Sema4b T A 7: 80,220,152 I396N probably damaging Het
Serpina3k T A 12: 104,341,107 D199E probably benign Het
Slc19a1 A G 10: 77,049,706 D480G possibly damaging Het
Slc8b1 G A 5: 120,527,815 V404M probably damaging Het
Slco1a4 T C 6: 141,819,604 D304G probably benign Het
Smpdl3b G T 4: 132,745,141 A107D possibly damaging Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Tmem245 A G 4: 56,937,940 F203L probably benign Het
Tnip1 T A 11: 54,918,716 I442F probably benign Het
Txnip A G 3: 96,559,123 K127R possibly damaging Het
Usp32 A C 11: 85,032,088 L172R probably damaging Het
Vmn2r66 A G 7: 85,005,228 S508P possibly damaging Het
Vwa5b2 T A 16: 20,598,202 Y550N probably damaging Het
Wdr81 G A 11: 75,451,786 A885V probably benign Het
Other mutations in Hook2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Hook2 APN 8 85002497 unclassified probably benign
IGL01161:Hook2 APN 8 84994931 missense probably benign 0.05
IGL01535:Hook2 APN 8 85002989 missense probably benign 0.00
IGL01668:Hook2 APN 8 84993578 missense possibly damaging 0.88
IGL01749:Hook2 APN 8 84993236 critical splice donor site probably null
IGL01750:Hook2 APN 8 84993236 critical splice donor site probably null
IGL01753:Hook2 APN 8 84993236 critical splice donor site probably null
IGL01900:Hook2 APN 8 85001311 unclassified probably benign
IGL02157:Hook2 APN 8 85001150 unclassified probably benign
IGL02175:Hook2 APN 8 84991402 missense probably damaging 1.00
IGL02350:Hook2 APN 8 84994985 nonsense probably null
IGL02357:Hook2 APN 8 84994985 nonsense probably null
IGL03377:Hook2 APN 8 85001335 nonsense probably null
R0399:Hook2 UTSW 8 84993567 splice site probably benign
R1133:Hook2 UTSW 8 84995804 missense probably damaging 1.00
R2087:Hook2 UTSW 8 85002691 missense probably damaging 0.98
R2277:Hook2 UTSW 8 85002931 nonsense probably null
R2398:Hook2 UTSW 8 84991299 missense probably damaging 0.98
R3406:Hook2 UTSW 8 84993984 splice site probably benign
R4752:Hook2 UTSW 8 85002720 nonsense probably null
R5014:Hook2 UTSW 8 84991377 missense probably damaging 1.00
R5068:Hook2 UTSW 8 84993399 missense possibly damaging 0.81
R5195:Hook2 UTSW 8 84994776 missense probably damaging 1.00
R5360:Hook2 UTSW 8 85001404 missense probably damaging 1.00
R5597:Hook2 UTSW 8 84994028 missense probably benign 0.00
R5614:Hook2 UTSW 8 85002508 missense probably damaging 1.00
R5843:Hook2 UTSW 8 84991283 missense probably damaging 0.99
R5931:Hook2 UTSW 8 84995746 nonsense probably null
R5942:Hook2 UTSW 8 84994780 splice site probably null
R6120:Hook2 UTSW 8 84998125 missense probably damaging 1.00
R6167:Hook2 UTSW 8 84995013 missense probably damaging 1.00
R6936:Hook2 UTSW 8 85002998 missense probably benign 0.04
R7058:Hook2 UTSW 8 84997411 missense possibly damaging 0.89
R7101:Hook2 UTSW 8 84997051 missense probably benign
R7177:Hook2 UTSW 8 84991417 missense probably benign 0.07
R8072:Hook2 UTSW 8 84994491 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTGTGTTGCCTAGAATGCATG -3'
(R):5'- TATGACCCACATGACCTCCCTG -3'

Sequencing Primer
(F):5'- TTGCCTAGAATGCATGAGGCC -3'
(R):5'- TCACCATGCTGTACCAGGC -3'
Posted On2019-05-13