Mutagenetix > Incidental Mutation

Incidental Mutation 'R6992:Pdzd2'

543930

Institutional Source

Beutler Lab

Gene Symbol

Pdzd2

Ensembl Gene

ENSMUSG00000022197

Gene Name

PDZ domain containing 2

Synonyms

Pdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.144) question?

Stock #

R6992 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12359711-12739924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12457859 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 306 (D306G)

Ref Sequence

ENSEMBL: ENSMUSP00000074788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075317] [ENSMUST00000186113] [ENSMUST00000189324] [ENSMUST00000190929]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000075317
AA Change: D306G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: D306G

Domain	Start	End	E-Value	Type
PDZ	81	179	1.27e-2	SMART
PDZ	342	419	1.51e-18	SMART
PDZ	597	675	5.25e-18	SMART
low complexity region	690	718	N/A	INTRINSIC
PDZ	738	817	1.64e-10	SMART
low complexity region	861	869	N/A	INTRINSIC
low complexity region	969	984	N/A	INTRINSIC
low complexity region	986	1000	N/A	INTRINSIC
low complexity region	1436	1459	N/A	INTRINSIC
low complexity region	1525	1537	N/A	INTRINSIC
low complexity region	1538	1553	N/A	INTRINSIC
low complexity region	1567	1586	N/A	INTRINSIC
low complexity region	2111	2129	N/A	INTRINSIC
low complexity region	2190	2198	N/A	INTRINSIC
low complexity region	2335	2354	N/A	INTRINSIC
low complexity region	2469	2479	N/A	INTRINSIC
PDZ	2589	2666	1.3e-13	SMART
PDZ	2716	2794	9.42e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186113

Predicted Effect

probably benign
Transcript: ENSMUST00000189324

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190929
AA Change: D132G

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000140682
Gene: ENSMUSG00000022197
AA Change: D132G

Domain	Start	End	E-Value	Type
PDZ	168	245	3e-20	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	T	C	9: 92,354,672	M128T	probably benign	Het
4921539E11Rik	C	T	4: 103,242,793	S171N	possibly damaging	Het
6030468B19Rik	T	G	11: 117,797,768	M1R	probably null	Het
9530053A07Rik	T	A	7: 28,140,183	F474I	probably benign	Het
A730049H05Rik	T	C	6: 92,827,994		probably benign	Het
AC125199.3	G	T	16: 88,812,027	H52Q	possibly damaging	Het
Adam34	A	T	8: 43,652,605	M1K	probably null	Het
Adgrf5	T	C	17: 43,452,323		probably null	Het
Antxr2	T	C	5: 97,960,705	T316A	probably benign	Het
Cc2d1a	A	T	8: 84,134,913	V714D	probably damaging	Het
Cd96	A	G	16: 46,049,724	S461P	possibly damaging	Het
Cdc16	C	A	8: 13,759,188	A51E	probably benign	Het
Chd4	T	A	6: 125,114,376	D1243E	probably benign	Het
Cntf	A	T	19: 12,765,333	I21N	probably damaging	Het
Col11a2	C	T	17: 34,047,144	A282V	probably benign	Het
Col14a1	T	A	15: 55,411,562		probably null	Het
Cyp2b9	T	C	7: 26,201,139	Y401H	probably benign	Het
Dlgap4	A	G	2: 156,748,940		probably null	Het
Fancd2	T	C	6: 113,571,018		probably null	Het
Frem1	A	G	4: 82,940,362	V1622A	possibly damaging	Het
Golm1	ACTTCTTCT	ACTTCT	13: 59,649,576		probably benign	Het
Gstm4	A	G	3: 108,044,665	M3T	possibly damaging	Het
Hdac10	T	C	15: 89,125,331	D466G	probably benign	Het
Hook2	A	G	8: 85,002,556	E625G	probably damaging	Het
Hspbp1	G	C	7: 4,664,715	P260A	probably benign	Het
Igdcc3	C	A	9: 65,181,571	Q411K	probably damaging	Het
Il18rap	G	A	1: 40,542,035	E356K	probably benign	Het
Inpp4a	A	T	1: 37,389,691	M699L	probably damaging	Het
Klhdc1	A	G	12: 69,253,757	H157R	probably damaging	Het
Klhl6	G	T	16: 19,953,587	T336N	probably damaging	Het
March7	T	C	2: 60,229,084		probably null	Het
Mast4	C	T	13: 102,804,647	V301I	probably damaging	Het
Mlh3	T	A	12: 85,235,720	N1412Y	probably damaging	Het
Mrps27	A	G	13: 99,405,014	M209V	probably benign	Het
Mtor	A	T	4: 148,464,475	T572S	probably benign	Het
Neurog1	T	C	13: 56,251,550	K128R	probably damaging	Het
Olfr124	T	A	17: 37,805,863	N239K	probably damaging	Het
Olfr1484	A	G	19: 13,585,447	I48V	possibly damaging	Het
Olfr981	T	A	9: 40,022,600	L69*	probably null	Het
Pcdhgb1	A	G	18: 37,681,599	K381R	probably benign	Het
Plekha5	C	T	6: 140,543,908	T237I	probably damaging	Het
Pole	A	T	5: 110,332,499	I103F	probably damaging	Het
Ppfia2	A	T	10: 106,474,854	Q74L	possibly damaging	Het
Ppm1d	T	C	11: 85,332,352	F261S	probably damaging	Het
Psg21	A	T	7: 18,654,743		probably null	Het
Ptprg	T	A	14: 11,962,602	F133L	probably damaging	Het
Rom1	G	A	19: 8,929,205		probably benign	Het
Rtn3	A	G	19: 7,435,124	F762L	probably damaging	Het
Sec23ip	T	C	7: 128,765,440	S600P	probably benign	Het
Sema4b	T	A	7: 80,220,152	I396N	probably damaging	Het
Serpina3k	T	A	12: 104,341,107	D199E	probably benign	Het
Slc19a1	A	G	10: 77,049,706	D480G	possibly damaging	Het
Slc8b1	G	A	5: 120,527,815	V404M	probably damaging	Het
Slco1a4	T	C	6: 141,819,604	D304G	probably benign	Het
Smpdl3b	G	T	4: 132,745,141	A107D	possibly damaging	Het
Tesk1	A	G	4: 43,447,006	T465A	probably benign	Het
Tmem245	A	G	4: 56,937,940	F203L	probably benign	Het
Tnip1	T	A	11: 54,918,716	I442F	probably benign	Het
Txnip	A	G	3: 96,559,123	K127R	possibly damaging	Het
Usp32	A	C	11: 85,032,088	L172R	probably damaging	Het
Vmn2r66	A	G	7: 85,005,228	S508P	possibly damaging	Het
Vwa5b2	T	A	16: 20,598,202	Y550N	probably damaging	Het
Wdr81	G	A	11: 75,451,786	A885V	probably benign	Het

Other mutations in Pdzd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pdzd2	APN	15	12457983	missense	possibly damaging	0.93
IGL00586:Pdzd2	APN	15	12365767	splice site	probably null
IGL00697:Pdzd2	APN	15	12373647	missense	possibly damaging	0.81
IGL00721:Pdzd2	APN	15	12374412	missense	probably benign	0.00
IGL00971:Pdzd2	APN	15	12374718	missense	probably benign	0.00
IGL01066:Pdzd2	APN	15	12402632	unclassified	probably benign
IGL01389:Pdzd2	APN	15	12374626	missense	possibly damaging	0.56
IGL01505:Pdzd2	APN	15	12458207	missense	probably damaging	1.00
IGL01527:Pdzd2	APN	15	12445664	missense	probably damaging	1.00
IGL01584:Pdzd2	APN	15	12592483	missense	probably damaging	1.00
IGL01763:Pdzd2	APN	15	12372546	missense	probably benign
IGL01915:Pdzd2	APN	15	12371639	missense	probably damaging	1.00
IGL01947:Pdzd2	APN	15	12592354	missense	probably damaging	1.00
IGL02058:Pdzd2	APN	15	12376296	missense	possibly damaging	0.87
IGL02274:Pdzd2	APN	15	12445649	missense	probably damaging	1.00
IGL02408:Pdzd2	APN	15	12375765	missense	probably benign	0.00
IGL02600:Pdzd2	APN	15	12411019	missense	probably damaging	1.00
IGL02637:Pdzd2	APN	15	12385634	missense	probably benign	0.13
IGL02639:Pdzd2	APN	15	12592243	missense	probably damaging	1.00
IGL02712:Pdzd2	APN	15	12376027	missense	probably benign	0.00
IGL02967:Pdzd2	APN	15	12374341	missense	probably benign	0.04
IGL02992:Pdzd2	APN	15	12382622	missense	possibly damaging	0.77
IGL03005:Pdzd2	APN	15	12385265	missense	probably damaging	1.00
IGL03067:Pdzd2	APN	15	12388542	critical splice donor site	probably null
IGL03335:Pdzd2	APN	15	12373764	missense	probably benign	0.00
PIT4280001:Pdzd2	UTSW	15	12399288	missense	probably damaging	1.00
R0022:Pdzd2	UTSW	15	12371605	missense	possibly damaging	0.94
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0446:Pdzd2	UTSW	15	12375024	missense	probably benign	0.43
R0462:Pdzd2	UTSW	15	12592160	missense	probably damaging	1.00
R0562:Pdzd2	UTSW	15	12592278	missense	probably damaging	1.00
R0589:Pdzd2	UTSW	15	12376299	missense	probably benign	0.03
R0639:Pdzd2	UTSW	15	12458058	missense	possibly damaging	0.77
R0925:Pdzd2	UTSW	15	12399270	missense	probably damaging	1.00
R1015:Pdzd2	UTSW	15	12374508	missense	probably damaging	1.00
R1054:Pdzd2	UTSW	15	12371639	missense	probably damaging	1.00
R1070:Pdzd2	UTSW	15	12389966	critical splice donor site	probably null
R1099:Pdzd2	UTSW	15	12373087	missense	probably damaging	1.00
R1122:Pdzd2	UTSW	15	12457895	missense	probably benign	0.25
R1126:Pdzd2	UTSW	15	12458220	missense	possibly damaging	0.94
R1381:Pdzd2	UTSW	15	12385439	missense	probably benign	0.02
R1385:Pdzd2	UTSW	15	12411022	missense	probably benign	0.38
R1513:Pdzd2	UTSW	15	12373829	missense	possibly damaging	0.88
R1538:Pdzd2	UTSW	15	12372961	missense	probably damaging	1.00
R1750:Pdzd2	UTSW	15	12385864	missense	probably damaging	1.00
R1775:Pdzd2	UTSW	15	12592460	missense	probably damaging	1.00
R1801:Pdzd2	UTSW	15	12387654	missense	possibly damaging	0.56
R1832:Pdzd2	UTSW	15	12390048	missense	probably damaging	1.00
R1856:Pdzd2	UTSW	15	12373855	missense	possibly damaging	0.87
R1870:Pdzd2	UTSW	15	12457886	missense	probably damaging	1.00
R1879:Pdzd2	UTSW	15	12373900	missense	possibly damaging	0.61
R2072:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2073:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2075:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2125:Pdzd2	UTSW	15	12373590	missense	probably benign	0.37
R2142:Pdzd2	UTSW	15	12406559	missense	probably damaging	1.00
R2155:Pdzd2	UTSW	15	12375793	missense	probably benign	0.43
R2282:Pdzd2	UTSW	15	12373848	missense	possibly damaging	0.95
R2407:Pdzd2	UTSW	15	12373161	missense	probably damaging	1.00
R3545:Pdzd2	UTSW	15	12375471	missense	probably benign	0.00
R3878:Pdzd2	UTSW	15	12376176	missense	probably benign	0.00
R3879:Pdzd2	UTSW	15	12375508	missense	probably damaging	1.00
R4396:Pdzd2	UTSW	15	12387646	missense	probably benign	0.36
R4398:Pdzd2	UTSW	15	12375975	missense	probably benign	0.30
R4491:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12419481	missense	possibly damaging	0.48
R4656:Pdzd2	UTSW	15	12385711	missense	probably benign	0.00
R4715:Pdzd2	UTSW	15	12419516	missense	possibly damaging	0.72
R4803:Pdzd2	UTSW	15	12374595	missense	probably benign	0.04
R4893:Pdzd2	UTSW	15	12385343	missense	probably benign	0.00
R4959:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R4973:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R5030:Pdzd2	UTSW	15	12592408	nonsense	probably null
R5174:Pdzd2	UTSW	15	12372514	missense	probably benign	0.01
R5230:Pdzd2	UTSW	15	12390033	missense	probably damaging	1.00
R5256:Pdzd2	UTSW	15	12372942	missense	possibly damaging	0.87
R5268:Pdzd2	UTSW	15	12592177	missense	probably damaging	1.00
R5488:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5489:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5588:Pdzd2	UTSW	15	12374281	missense	possibly damaging	0.48
R5605:Pdzd2	UTSW	15	12592350	nonsense	probably null
R5704:Pdzd2	UTSW	15	12385675	missense	probably benign	0.02
R5858:Pdzd2	UTSW	15	12442589	missense	probably damaging	0.97
R6048:Pdzd2	UTSW	15	12592570	splice site	probably null
R6222:Pdzd2	UTSW	15	12374566	missense	probably damaging	1.00
R6311:Pdzd2	UTSW	15	12458188	missense	probably damaging	1.00
R6734:Pdzd2	UTSW	15	12592465	missense	probably damaging	1.00
R6897:Pdzd2	UTSW	15	12385865	missense	probably damaging	1.00
R6900:Pdzd2	UTSW	15	12374037	missense	probably benign
R6955:Pdzd2	UTSW	15	12401464	missense	probably damaging	1.00
R6959:Pdzd2	UTSW	15	12375907	missense	probably benign	0.17
R7014:Pdzd2	UTSW	15	12372561	missense	probably benign	0.13
R7014:Pdzd2	UTSW	15	12372975	missense	probably benign	0.14
R7110:Pdzd2	UTSW	15	12368013	missense	probably damaging	1.00
R7180:Pdzd2	UTSW	15	12376123	missense	probably damaging	0.99
R7228:Pdzd2	UTSW	15	12372973	missense	probably benign	0.01
R7228:Pdzd2	UTSW	15	12458145	nonsense	probably null
R7317:Pdzd2	UTSW	15	12592243	missense	probably damaging	1.00
R7322:Pdzd2	UTSW	15	12437162	missense	probably damaging	1.00
R7349:Pdzd2	UTSW	15	12399205	missense	probably damaging	1.00
R7600:Pdzd2	UTSW	15	12372734	missense	probably damaging	1.00
R7663:Pdzd2	UTSW	15	12373203	missense	probably damaging	1.00
R7712:Pdzd2	UTSW	15	12407336	missense	probably damaging	1.00
R7716:Pdzd2	UTSW	15	12373374	missense	possibly damaging	0.63
R7740:Pdzd2	UTSW	15	12374016	missense	probably benign	0.00
R7748:Pdzd2	UTSW	15	12385786	missense	possibly damaging	0.60
R8017:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8019:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8108:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8109:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8110:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8111:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8145:Pdzd2	UTSW	15	12407372	missense	probably benign	0.37
R8220:Pdzd2	UTSW	15	12592163	missense	probably damaging	0.99
R8278:Pdzd2	UTSW	15	12375909	missense	probably benign
R8768:Pdzd2	UTSW	15	12437166	missense	probably damaging	1.00
R8879:Pdzd2	UTSW	15	12402319	missense	probably damaging	1.00
R9019:Pdzd2	UTSW	15	12375526	missense	probably damaging	1.00
R9030:Pdzd2	UTSW	15	12374299	missense	probably benign	0.02
R9061:Pdzd2	UTSW	15	12374667	missense	possibly damaging	0.94
R9302:Pdzd2	UTSW	15	12374256	missense	possibly damaging	0.61
R9321:Pdzd2	UTSW	15	12385937	missense	probably benign	0.00
R9421:Pdzd2	UTSW	15	12375028	missense
R9515:Pdzd2	UTSW	15	12374535	missense	probably damaging	1.00
R9592:Pdzd2	UTSW	15	12458020	missense	probably damaging	1.00
R9614:Pdzd2	UTSW	15	12375400	missense	probably damaging	1.00
R9630:Pdzd2	UTSW	15	12374357	missense	probably benign	0.37
R9776:Pdzd2	UTSW	15	12457823	missense	probably benign	0.03
X0057:Pdzd2	UTSW	15	12411027	missense	probably damaging	1.00
X0063:Pdzd2	UTSW	15	12368719	missense	possibly damaging	0.77
X0066:Pdzd2	UTSW	15	12372856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCAGATTCTAGGACAGCGAGC -3'
(R):5'- AGTTGGAGAACGGTACCGACTC -3'

Sequencing Primer
(F):5'- TTGCCTTGCAAGCATCGAG -3'
(R):5'- CTCCGAACTTGGAAATGGCCATG -3'

Posted On

2019-05-13