Mutagenetix > Incidental Mutation

Incidental Mutation 'R6993:Dnah7b'

543944

Institutional Source

Beutler Lab

Gene Symbol

Dnah7b

Ensembl Gene

ENSMUSG00000041144

Gene Name

dynein, axonemal, heavy chain 7B

Synonyms

Dnahc7b, LOC227058

MMRRC Submission

045099-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R6993 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46066315-46373546 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 46195139 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000068738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069293]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000069293

SMART Domains

Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144

Domain	Start	End	E-Value	Type
coiled coil region	760	790	N/A	INTRINSIC
Pfam:DHC_N2	800	1209	3.7e-150	PFAM
AAA	1364	1503	3.24e-1	SMART
AAA	2012	2160	5.39e-2	SMART
Pfam:AAA_8	2347	2618	2.4e-75	PFAM
Pfam:MT	2630	2979	2.6e-54	PFAM
Pfam:AAA_9	3001	3226	2.3e-98	PFAM
Pfam:Dynein_heavy	3362	4064	8.4e-288	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (66/67)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	T	C	8: 79,248,424	E10G	possibly damaging	Het
Akap9	A	G	5: 4,065,866	I3429V	possibly damaging	Het
Braf	T	A	6: 39,643,163	I441F	probably damaging	Het
C5ar1	A	T	7: 16,248,912	V61E	probably damaging	Het
Camk2a	C	A	18: 60,943,175		probably benign	Het
Cd163	A	G	6: 124,317,714	Y579C	probably damaging	Het
Celf1	T	C	2: 91,010,476	Y363H	probably damaging	Het
Cntn3	T	C	6: 102,278,404	T178A	probably damaging	Het
Cryab	C	T	9: 50,753,448	P58S	probably benign	Het
Ctsf	G	T	19: 4,858,483	R290L	probably benign	Het
Ctsw	T	A	19: 5,465,837	I258F	probably damaging	Het
Drg1	TCATCTTCCA	TCA	11: 3,250,294		probably null	Het
Etfb	A	G	7: 43,456,554	T172A	possibly damaging	Het
Etfdh	A	G	3: 79,612,031	Y272H	probably benign	Het
Ewsr1	C	T	11: 5,071,573	R454Q	probably benign	Het
F2rl2	T	A	13: 95,701,134	I229N	probably damaging	Het
Fam162a	A	T	16: 36,049,845	I88N	probably damaging	Het
Fastkd5	A	G	2: 130,616,539	S44P	probably benign	Het
Fat3	T	G	9: 15,919,221	S4326R	probably damaging	Het
Fbf1	T	C	11: 116,152,784	K400E	probably benign	Het
Fndc7	A	G	3: 108,876,591	V234A	probably benign	Het
Gfi1	T	A	5: 107,717,768	H481L	probably damaging	Het
Gm5591	T	A	7: 38,519,223	H742L	probably benign	Het
Gm5724	G	A	6: 141,765,742	T81I	possibly damaging	Het
Gm853	A	G	4: 130,218,313	L192P	probably damaging	Het
Golm1	ACTTCTTCT	ACTTCT	13: 59,649,576		probably benign	Het
H2-DMb1	A	C	17: 34,157,350	T148P	possibly damaging	Het
H2-T3	A	G	17: 36,187,070	L317P	probably damaging	Het
Hes3	T	C	4: 152,286,923	T190A	probably benign	Het
Hivep1	C	T	13: 42,158,714	L1477F	possibly damaging	Het
Insr	C	T	8: 3,258,752	G95S	probably damaging	Het
Irf9	A	G	14: 55,608,957	I394V	probably benign	Het
Kat2b	T	C	17: 53,638,522	L323P	probably damaging	Het
Kdr	T	C	5: 75,972,411	D69G	probably benign	Het
Krt2	C	T	15: 101,815,960	E290K	probably damaging	Het
Krtap4-6	G	T	11: 99,665,719	R61S	unknown	Het
Lrrc27	A	T	7: 139,242,624	K477M	probably damaging	Het
Lvrn	T	C	18: 46,882,298	V579A	probably benign	Het
Malrd1	A	T	2: 16,150,791	I2004L	unknown	Het
Mast4	A	T	13: 102,735,974	N2103K	probably benign	Het
Mast4	C	T	13: 102,804,647	V301I	probably damaging	Het
Myo18a	T	A	11: 77,859,074		probably benign	Het
Olfr597	G	T	7: 103,320,791		probably benign	Het
Olfr975	T	A	9: 39,950,637	M45L	probably benign	Het
Pcdhga10	A	G	18: 37,749,256	Y690C	probably damaging	Het
Pdcd2	A	G	17: 15,527,081	Y65H	probably damaging	Het
Ppp1r12a	A	G	10: 108,240,837	E309G	probably benign	Het
Psmb8	A	G	17: 34,199,643	D123G	probably damaging	Het
Ptcd3	A	T	6: 71,885,315	W513R	probably damaging	Het
Ptx4	G	A	17: 25,124,924	V383I	possibly damaging	Het
Ric1	T	C	19: 29,586,613	L589S	probably damaging	Het
Rmnd5b	A	G	11: 51,624,600		probably benign	Het
Sec16a	A	T	2: 26,423,574	S1925T	probably damaging	Het
Slc16a11	T	A	11: 70,216,016	M360K	possibly damaging	Het
Slc19a2	T	A	1: 164,260,822	F79I	probably benign	Het
Slc2a6	G	T	2: 27,027,243	S45R	probably damaging	Het
Sppl3	T	A	5: 115,082,290	M87K	probably damaging	Het
Tbcel	A	T	9: 42,416,117	L330*	probably null	Het
Tbx5	A	T	5: 119,871,389	Y321F	possibly damaging	Het
Tenm3	C	T	8: 48,236,439	D2038N	probably damaging	Het
Tesk1	A	G	4: 43,447,006	T465A	probably benign	Het
Unc45a	A	T	7: 80,325,655	Y934N	probably damaging	Het
Unc80	A	T	1: 66,549,793	Q1039L	possibly damaging	Het
Vmn2r112	T	C	17: 22,603,214	L291P	probably benign	Het
Wwc2	A	T	8: 47,847,465	F988I	unknown	Het
Zfp947	G	A	17: 22,145,980	P238S	probably benign	Het

Other mutations in Dnah7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Dnah7b	APN	1	46142149	missense	probably benign	0.04
IGL00796:Dnah7b	APN	1	46211337	missense	probably damaging	0.96
IGL00825:Dnah7b	APN	1	46224651	missense	probably damaging	1.00
IGL00910:Dnah7b	APN	1	46066729	unclassified	probably benign
IGL00950:Dnah7b	APN	1	46214322	missense	probably benign	0.07
IGL01142:Dnah7b	APN	1	46195378	critical splice donor site	probably null
IGL01350:Dnah7b	APN	1	46081432	splice site	probably benign
IGL01392:Dnah7b	APN	1	46126788	missense	probably damaging	1.00
IGL01403:Dnah7b	APN	1	46116300	splice site	probably benign
IGL01460:Dnah7b	APN	1	46139704	missense	possibly damaging	0.82
IGL01576:Dnah7b	APN	1	46268653	missense	probably damaging	1.00
IGL01693:Dnah7b	APN	1	46358147	missense	probably benign	0.29
IGL01838:Dnah7b	APN	1	46358137	nonsense	probably null
IGL01906:Dnah7b	APN	1	46175453	missense	probably damaging	1.00
IGL01960:Dnah7b	APN	1	46124337	splice site	probably benign
IGL01989:Dnah7b	APN	1	46289534	missense	probably damaging	1.00
IGL02127:Dnah7b	APN	1	46139875	missense	probably benign
IGL02213:Dnah7b	APN	1	46233592	missense	probably damaging	0.97
IGL02267:Dnah7b	APN	1	46226930	missense	probably damaging	1.00
IGL02349:Dnah7b	APN	1	46099503	nonsense	probably null
IGL02381:Dnah7b	APN	1	46277120	missense	probably damaging	1.00
IGL02473:Dnah7b	APN	1	46234193	missense	probably damaging	1.00
IGL02484:Dnah7b	APN	1	46195318	missense	probably damaging	1.00
IGL02590:Dnah7b	APN	1	46123777	missense	probably benign	0.02
IGL02655:Dnah7b	APN	1	46116301	splice site	probably benign
IGL02704:Dnah7b	APN	1	46142133	missense	probably benign	0.03
IGL02719:Dnah7b	APN	1	46099608	splice site	probably benign
IGL02745:Dnah7b	APN	1	46195029	splice site	probably benign
IGL02818:Dnah7b	APN	1	46290808	missense	probably damaging	1.00
IGL02892:Dnah7b	APN	1	46119298	missense	possibly damaging	0.79
IGL03285:Dnah7b	APN	1	46182375	missense	probably benign	0.00
IGL03354:Dnah7b	APN	1	46085689	missense	probably damaging	1.00
IGL03355:Dnah7b	APN	1	46119304	missense	probably benign	0.18
BB001:Dnah7b	UTSW	1	46219430	missense	probably benign	0.04
BB011:Dnah7b	UTSW	1	46219430	missense	probably benign	0.04
PIT4305001:Dnah7b	UTSW	1	46373348	missense	probably damaging	1.00
R0116:Dnah7b	UTSW	1	46213360	missense	possibly damaging	0.94
R0145:Dnah7b	UTSW	1	46223178	missense	probably damaging	1.00
R0230:Dnah7b	UTSW	1	46219348	missense	probably damaging	1.00
R0302:Dnah7b	UTSW	1	46123777	missense	probably benign	0.26
R0313:Dnah7b	UTSW	1	46207643	missense	probably damaging	1.00
R0317:Dnah7b	UTSW	1	46134656	missense	probably damaging	1.00
R0347:Dnah7b	UTSW	1	46240944	missense	probably damaging	1.00
R0352:Dnah7b	UTSW	1	46277126	missense	probably damaging	0.98
R0363:Dnah7b	UTSW	1	46236788	missense	probably damaging	0.99
R0379:Dnah7b	UTSW	1	46140176	missense	probably benign	0.00
R0502:Dnah7b	UTSW	1	46219544	missense	probably damaging	0.96
R0602:Dnah7b	UTSW	1	46324842	missense	probably damaging	1.00
R0631:Dnah7b	UTSW	1	46240992	missense	probably benign	0.02
R0664:Dnah7b	UTSW	1	46324842	missense	probably damaging	1.00
R0882:Dnah7b	UTSW	1	46340132	missense	probably benign	0.00
R0931:Dnah7b	UTSW	1	46099612	splice site	probably benign
R1035:Dnah7b	UTSW	1	46124448	missense	probably benign
R1147:Dnah7b	UTSW	1	46340266	missense	probably damaging	0.99
R1147:Dnah7b	UTSW	1	46340266	missense	probably damaging	0.99
R1166:Dnah7b	UTSW	1	46325810	missense	probably damaging	1.00
R1219:Dnah7b	UTSW	1	46340120	missense	probably benign	0.00
R1318:Dnah7b	UTSW	1	46099509	missense	possibly damaging	0.80
R1334:Dnah7b	UTSW	1	46322335	missense	probably damaging	0.99
R1429:Dnah7b	UTSW	1	46289656	missense	possibly damaging	0.84
R1440:Dnah7b	UTSW	1	46078593	splice site	probably benign
R1484:Dnah7b	UTSW	1	46137543	missense	probably benign	0.00
R1529:Dnah7b	UTSW	1	46177281	missense	probably damaging	1.00
R1544:Dnah7b	UTSW	1	46066797	missense	unknown
R1607:Dnah7b	UTSW	1	46290646	missense	probably damaging	1.00
R1609:Dnah7b	UTSW	1	46352966	missense	probably damaging	1.00
R1652:Dnah7b	UTSW	1	46175390	nonsense	probably null
R1681:Dnah7b	UTSW	1	46324712	nonsense	probably null
R1716:Dnah7b	UTSW	1	46191783	missense	probably damaging	1.00
R1753:Dnah7b	UTSW	1	46322335	missense	probably damaging	0.99
R1834:Dnah7b	UTSW	1	46233759	missense	possibly damaging	0.90
R1838:Dnah7b	UTSW	1	46116177	missense	probably benign	0.04
R1838:Dnah7b	UTSW	1	46277105	missense	probably damaging	1.00
R1898:Dnah7b	UTSW	1	46236714	missense	probably benign	0.02
R1962:Dnah7b	UTSW	1	46242103	missense	possibly damaging	0.95
R2001:Dnah7b	UTSW	1	46142087	missense	possibly damaging	0.69
R2049:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2076:Dnah7b	UTSW	1	46242321	nonsense	probably null
R2083:Dnah7b	UTSW	1	46241067	missense	possibly damaging	0.90
R2140:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2141:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2142:Dnah7b	UTSW	1	46268670	missense	probably damaging	1.00
R2165:Dnah7b	UTSW	1	46097992	splice site	probably benign
R2172:Dnah7b	UTSW	1	46124512	missense	probably benign	0.12
R2239:Dnah7b	UTSW	1	46201184	splice site	probably benign
R2247:Dnah7b	UTSW	1	46277063	missense	probably damaging	1.00
R2267:Dnah7b	UTSW	1	46233915	missense	probably damaging	1.00
R2405:Dnah7b	UTSW	1	46362954	missense	probably benign	0.31
R2509:Dnah7b	UTSW	1	46195287	missense	probably damaging	0.96
R2895:Dnah7b	UTSW	1	46139741	missense	probably damaging	1.00
R2965:Dnah7b	UTSW	1	46207572	missense	probably damaging	1.00
R3013:Dnah7b	UTSW	1	46188687	critical splice donor site	probably null
R3022:Dnah7b	UTSW	1	46182423	missense	probably damaging	0.99
R3056:Dnah7b	UTSW	1	46268709	missense	possibly damaging	0.95
R3107:Dnah7b	UTSW	1	46352873	missense	probably benign	0.00
R3735:Dnah7b	UTSW	1	46299875	missense	probably benign	0.05
R3898:Dnah7b	UTSW	1	46243257	missense	probably damaging	1.00
R3944:Dnah7b	UTSW	1	46137485	missense	probably damaging	1.00
R3983:Dnah7b	UTSW	1	46233711	missense	possibly damaging	0.88
R4041:Dnah7b	UTSW	1	46081495	missense	probably benign
R4172:Dnah7b	UTSW	1	46226946	missense	probably damaging	1.00
R4210:Dnah7b	UTSW	1	46137418	missense	possibly damaging	0.63
R4306:Dnah7b	UTSW	1	46221772	missense	probably damaging	0.99
R4391:Dnah7b	UTSW	1	46337594	splice site	probably null
R4414:Dnah7b	UTSW	1	46126680	missense	probably benign	0.00
R4495:Dnah7b	UTSW	1	46085632	missense	probably benign	0.00
R4660:Dnah7b	UTSW	1	46289536	missense	probably damaging	1.00
R4670:Dnah7b	UTSW	1	46078524	missense	probably damaging	1.00
R4675:Dnah7b	UTSW	1	46217157	missense	possibly damaging	0.89
R4685:Dnah7b	UTSW	1	46211328	missense	probably damaging	1.00
R4727:Dnah7b	UTSW	1	46207656	missense	probably damaging	1.00
R4735:Dnah7b	UTSW	1	46066955	missense	unknown
R4780:Dnah7b	UTSW	1	46353014	missense	probably benign
R4828:Dnah7b	UTSW	1	46128112	missense	possibly damaging	0.59
R4859:Dnah7b	UTSW	1	46356602	missense	probably damaging	1.00
R4865:Dnah7b	UTSW	1	46195074	missense	probably damaging	1.00
R4871:Dnah7b	UTSW	1	46081444	missense	probably benign	0.21
R4881:Dnah7b	UTSW	1	46201318	missense	probably damaging	1.00
R4902:Dnah7b	UTSW	1	46290775	missense	probably benign	0.04
R4960:Dnah7b	UTSW	1	46233726	missense	probably benign
R5000:Dnah7b	UTSW	1	46099503	nonsense	probably null
R5005:Dnah7b	UTSW	1	46242028	missense	probably damaging	0.99
R5026:Dnah7b	UTSW	1	46187363	missense	probably damaging	0.99
R5080:Dnah7b	UTSW	1	46182380	nonsense	probably null
R5174:Dnah7b	UTSW	1	46243349	missense	possibly damaging	0.83
R5178:Dnah7b	UTSW	1	46358216	missense	possibly damaging	0.50
R5244:Dnah7b	UTSW	1	46233858	missense	probably damaging	1.00
R5250:Dnah7b	UTSW	1	46373354	missense	probably damaging	1.00
R5350:Dnah7b	UTSW	1	46233689	missense	probably benign	0.16
R5380:Dnah7b	UTSW	1	46217191	missense	probably benign	0.18
R5387:Dnah7b	UTSW	1	46188659	missense	probably damaging	1.00
R5423:Dnah7b	UTSW	1	46358271	missense	probably benign	0.01
R5426:Dnah7b	UTSW	1	46242206	missense	possibly damaging	0.82
R5451:Dnah7b	UTSW	1	46242019	missense	possibly damaging	0.73
R5459:Dnah7b	UTSW	1	46109312	missense	probably null
R5479:Dnah7b	UTSW	1	46223105	missense	probably damaging	1.00
R5583:Dnah7b	UTSW	1	46242199	missense	probably benign	0.06
R5637:Dnah7b	UTSW	1	46356514	missense	possibly damaging	0.95
R5641:Dnah7b	UTSW	1	46268764	splice site	probably null
R5659:Dnah7b	UTSW	1	46352849	missense	probably damaging	1.00
R5739:Dnah7b	UTSW	1	46233992	missense	probably damaging	1.00
R5759:Dnah7b	UTSW	1	46277120	missense	probably damaging	1.00
R5821:Dnah7b	UTSW	1	46142132	missense	possibly damaging	0.91
R5874:Dnah7b	UTSW	1	46191725	missense	probably damaging	1.00
R5892:Dnah7b	UTSW	1	46337593	critical splice donor site	probably null
R5918:Dnah7b	UTSW	1	46221643	missense	probably benign
R5941:Dnah7b	UTSW	1	46187290	missense	probably damaging	1.00
R5965:Dnah7b	UTSW	1	46362987	missense	probably damaging	1.00
R5987:Dnah7b	UTSW	1	46119398	splice site	probably null
R6041:Dnah7b	UTSW	1	46289645	missense	probably benign	0.04
R6043:Dnah7b	UTSW	1	46139789	missense	probably benign
R6049:Dnah7b	UTSW	1	46085602	missense	probably benign
R6131:Dnah7b	UTSW	1	46253466	missense	probably damaging	1.00
R6168:Dnah7b	UTSW	1	46290703	missense	probably damaging	1.00
R6195:Dnah7b	UTSW	1	46204269	missense	probably damaging	1.00
R6219:Dnah7b	UTSW	1	46233585	missense	probably benign	0.03
R6226:Dnah7b	UTSW	1	46126668	missense	probably benign	0.01
R6233:Dnah7b	UTSW	1	46204269	missense	probably damaging	1.00
R6247:Dnah7b	UTSW	1	46225888	missense	probably benign
R6273:Dnah7b	UTSW	1	46242316	missense	possibly damaging	0.94
R6279:Dnah7b	UTSW	1	46325886	missense	probably damaging	1.00
R6300:Dnah7b	UTSW	1	46325886	missense	probably damaging	1.00
R6330:Dnah7b	UTSW	1	46340175	missense	probably damaging	1.00
R6476:Dnah7b	UTSW	1	46242204	nonsense	probably null
R6494:Dnah7b	UTSW	1	46099431	missense	probably damaging	1.00
R6762:Dnah7b	UTSW	1	46224742	missense	probably benign	0.12
R6800:Dnah7b	UTSW	1	46340217	missense	possibly damaging	0.90
R6838:Dnah7b	UTSW	1	46191788	missense	probably damaging	1.00
R6937:Dnah7b	UTSW	1	46195120	missense	probably damaging	1.00
R6940:Dnah7b	UTSW	1	46119268	missense	probably benign	0.12
R6969:Dnah7b	UTSW	1	46358238	missense	probably damaging	1.00
R7040:Dnah7b	UTSW	1	46236809	missense	probably benign	0.01
R7117:Dnah7b	UTSW	1	46352813	critical splice acceptor site	probably null
R7135:Dnah7b	UTSW	1	46139710	missense	probably damaging	0.99
R7153:Dnah7b	UTSW	1	46126804	missense	probably benign	0.05
R7189:Dnah7b	UTSW	1	46242142	missense	probably damaging	1.00
R7237:Dnah7b	UTSW	1	46139966	missense	probably damaging	0.98
R7243:Dnah7b	UTSW	1	46083754	missense	probably benign
R7244:Dnah7b	UTSW	1	46277143	missense	probably damaging	0.99
R7248:Dnah7b	UTSW	1	46142085	missense	possibly damaging	0.83
R7318:Dnah7b	UTSW	1	46195372	missense	probably damaging	1.00
R7375:Dnah7b	UTSW	1	46303634	missense	probably damaging	1.00
R7483:Dnah7b	UTSW	1	46175419	missense	probably damaging	1.00
R7486:Dnah7b	UTSW	1	46290734	missense	probably damaging	1.00
R7498:Dnah7b	UTSW	1	46325765	missense	probably damaging	1.00
R7501:Dnah7b	UTSW	1	46356554	missense	probably damaging	1.00
R7513:Dnah7b	UTSW	1	46124346	missense	probably benign	0.06
R7547:Dnah7b	UTSW	1	46214413	missense	possibly damaging	0.82
R7620:Dnah7b	UTSW	1	46268634	missense	probably damaging	1.00
R7670:Dnah7b	UTSW	1	46109302	missense	probably benign
R7676:Dnah7b	UTSW	1	46234164	nonsense	probably null
R7731:Dnah7b	UTSW	1	46139745	missense	probably benign	0.00
R7760:Dnah7b	UTSW	1	46201253	missense	probably damaging	1.00
R7768:Dnah7b	UTSW	1	46137474	missense	probably benign
R7807:Dnah7b	UTSW	1	46214367	missense	probably benign
R7895:Dnah7b	UTSW	1	46249950	missense	probably damaging	1.00
R7911:Dnah7b	UTSW	1	46139678	missense	probably damaging	1.00
R7924:Dnah7b	UTSW	1	46219430	missense	probably benign	0.04
R7944:Dnah7b	UTSW	1	46227003	missense	probably benign
R7946:Dnah7b	UTSW	1	46233579	missense	probably damaging	1.00
R7983:Dnah7b	UTSW	1	46243424	missense	probably damaging	1.00
R8012:Dnah7b	UTSW	1	46243365	missense	probably damaging	1.00
R8069:Dnah7b	UTSW	1	46224706	nonsense	probably null
R8094:Dnah7b	UTSW	1	46126804	missense	probably benign	0.01
R8137:Dnah7b	UTSW	1	46233753	missense	probably damaging	1.00
R8167:Dnah7b	UTSW	1	46253511	missense	possibly damaging	0.95
R8268:Dnah7b	UTSW	1	46356576	missense	probably benign	0.43
R8309:Dnah7b	UTSW	1	46139872	missense	probably damaging	1.00
R8313:Dnah7b	UTSW	1	46175296	missense	possibly damaging	0.81
R8410:Dnah7b	UTSW	1	46356659	critical splice donor site	probably null
R8438:Dnah7b	UTSW	1	46188679	missense	probably damaging	1.00
R8446:Dnah7b	UTSW	1	46290715	missense	probably damaging	1.00
R8471:Dnah7b	UTSW	1	46099490	missense	possibly damaging	0.92
R8551:Dnah7b	UTSW	1	46116200	missense	possibly damaging	0.94
R8711:Dnah7b	UTSW	1	46175438	missense	probably damaging	1.00
R8745:Dnah7b	UTSW	1	46182464	missense	possibly damaging	0.82
R8765:Dnah7b	UTSW	1	46352999	missense	possibly damaging	0.91
R8797:Dnah7b	UTSW	1	46123646	missense	probably damaging	1.00
R8805:Dnah7b	UTSW	1	46234145	missense	possibly damaging	0.90
R8830:Dnah7b	UTSW	1	46191793	missense	probably damaging	1.00
R8861:Dnah7b	UTSW	1	46241076	missense	possibly damaging	0.82
R8905:Dnah7b	UTSW	1	46253374	missense	probably damaging	0.99
R9009:Dnah7b	UTSW	1	46223072	missense	probably benign	0.00
R9058:Dnah7b	UTSW	1	46243415	missense	probably damaging	1.00
R9130:Dnah7b	UTSW	1	46134514	missense	probably benign	0.01
R9131:Dnah7b	UTSW	1	46227020	missense	probably damaging	1.00
R9181:Dnah7b	UTSW	1	46142034	missense	probably damaging	1.00
R9182:Dnah7b	UTSW	1	46290878	missense	probably benign	0.06
R9223:Dnah7b	UTSW	1	46322260	missense	probably benign	0.12
R9391:Dnah7b	UTSW	1	46233754	nonsense	probably null
R9392:Dnah7b	UTSW	1	46123738	nonsense	probably null
R9456:Dnah7b	UTSW	1	46126793	missense	possibly damaging	0.82
R9498:Dnah7b	UTSW	1	46214404	missense	probably benign	0.27
R9553:Dnah7b	UTSW	1	46225796	missense	probably damaging	0.99
R9598:Dnah7b	UTSW	1	46253461	missense	possibly damaging	0.67
R9653:Dnah7b	UTSW	1	46213384	missense	possibly damaging	0.55
R9781:Dnah7b	UTSW	1	46337594	splice site	probably null
RF020:Dnah7b	UTSW	1	46373261	missense	possibly damaging	0.84
V8831:Dnah7b	UTSW	1	46373298	nonsense	probably null
X0023:Dnah7b	UTSW	1	46303577	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GGGCAGTTTCCCAGTTGATC -3'
(R):5'- AGCACATGTGGGGTCAAGTTTTAG -3'

Sequencing Primer
(F):5'- GGTAAATAAGCAATTTCCTTGATGGG -3'
(R):5'- GTTCTGTTCCTTCAAACACTAGGAG -3'

Posted On

2019-05-13