Mutagenetix > Incidental Mutation

Incidental Mutation 'R6993:Slc19a2'

543946

Institutional Source

Beutler Lab

Gene Symbol

Slc19a2

Ensembl Gene

ENSMUSG00000040918

Gene Name

solute carrier family 19 (thiamine transporter), member 2

Synonyms

TRMA, DDA1, THTR1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R6993 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

164249046-164265385 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 164260822 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 79 (F79I)

Ref Sequence

ENSEMBL: ENSMUSP00000131327 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044021] [ENSMUST00000159230] [ENSMUST00000169394]

AlphaFold

Q9EQN9

Predicted Effect

probably benign
Transcript: ENSMUST00000044021
AA Change: F280I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000037561
Gene: ENSMUSG00000040918
AA Change: F280I

Domain	Start	End	E-Value	Type
low complexity region	5	24	N/A	INTRINSIC
Pfam:Folate_carrier	28	459	2.7e-180	PFAM
Pfam:MFS_1	34	441	2.6e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159230
AA Change: F242I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000123870
Gene: ENSMUSG00000040918
AA Change: F242I

Domain	Start	End	E-Value	Type
low complexity region	5	24	N/A	INTRINSIC
Pfam:Folate_carrier	28	421	1.6e-176	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169394
AA Change: F79I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000131327
Gene: ENSMUSG00000040918
AA Change: F79I

Domain	Start	End	E-Value	Type
low complexity region	5	24	N/A	INTRINSIC
Pfam:Folate_carrier	28	70	3.7e-17	PFAM
Pfam:Folate_carrier	65	258	6.7e-85	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the thiamin transporter protein. Mutations in this gene cause thiamin-responsive megaloblastic anemia syndrome (TRMA), which is an autosomal recessive disorder characterized by diabetes mellitus, megaloblastic anemia and sensorineural deafness. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for targeted null alleles exhibit a grossly normal phenotype except for reduced testis size and male infertility. On a low-thiamine diet, mutants show premature death and sensorineural deafness, while homozygotes for one targeted allele also display diabetes mellitus and megaloblastosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	T	C	8: 79,248,424	E10G	possibly damaging	Het
Akap9	A	G	5: 4,065,866	I3429V	possibly damaging	Het
Braf	T	A	6: 39,643,163	I441F	probably damaging	Het
C5ar1	A	T	7: 16,248,912	V61E	probably damaging	Het
Camk2a	C	A	18: 60,943,175		probably benign	Het
Cd163	A	G	6: 124,317,714	Y579C	probably damaging	Het
Celf1	T	C	2: 91,010,476	Y363H	probably damaging	Het
Cntn3	T	C	6: 102,278,404	T178A	probably damaging	Het
Cryab	C	T	9: 50,753,448	P58S	probably benign	Het
Ctsf	G	T	19: 4,858,483	R290L	probably benign	Het
Ctsw	T	A	19: 5,465,837	I258F	probably damaging	Het
Dnah7b	T	C	1: 46,195,139		probably null	Het
Drg1	TCATCTTCCA	TCA	11: 3,250,294		probably null	Het
Etfb	A	G	7: 43,456,554	T172A	possibly damaging	Het
Etfdh	A	G	3: 79,612,031	Y272H	probably benign	Het
Ewsr1	C	T	11: 5,071,573	R454Q	probably benign	Het
F2rl2	T	A	13: 95,701,134	I229N	probably damaging	Het
Fam162a	A	T	16: 36,049,845	I88N	probably damaging	Het
Fastkd5	A	G	2: 130,616,539	S44P	probably benign	Het
Fat3	T	G	9: 15,919,221	S4326R	probably damaging	Het
Fbf1	T	C	11: 116,152,784	K400E	probably benign	Het
Fndc7	A	G	3: 108,876,591	V234A	probably benign	Het
Gfi1	T	A	5: 107,717,768	H481L	probably damaging	Het
Gm5591	T	A	7: 38,519,223	H742L	probably benign	Het
Gm5724	G	A	6: 141,765,742	T81I	possibly damaging	Het
Gm853	A	G	4: 130,218,313	L192P	probably damaging	Het
Golm1	ACTTCTTCT	ACTTCT	13: 59,649,576		probably benign	Het
H2-DMb1	A	C	17: 34,157,350	T148P	possibly damaging	Het
H2-T3	A	G	17: 36,187,070	L317P	probably damaging	Het
Hes3	T	C	4: 152,286,923	T190A	probably benign	Het
Hivep1	C	T	13: 42,158,714	L1477F	possibly damaging	Het
Insr	C	T	8: 3,258,752	G95S	probably damaging	Het
Irf9	A	G	14: 55,608,957	I394V	probably benign	Het
Kat2b	T	C	17: 53,638,522	L323P	probably damaging	Het
Kdr	T	C	5: 75,972,411	D69G	probably benign	Het
Krt2	C	T	15: 101,815,960	E290K	probably damaging	Het
Krtap4-6	G	T	11: 99,665,719	R61S	unknown	Het
Lrrc27	A	T	7: 139,242,624	K477M	probably damaging	Het
Lvrn	T	C	18: 46,882,298	V579A	probably benign	Het
Malrd1	A	T	2: 16,150,791	I2004L	unknown	Het
Mast4	A	T	13: 102,735,974	N2103K	probably benign	Het
Mast4	C	T	13: 102,804,647	V301I	probably damaging	Het
Myo18a	T	A	11: 77,859,074		probably benign	Het
Olfr597	G	T	7: 103,320,791		probably benign	Het
Olfr975	T	A	9: 39,950,637	M45L	probably benign	Het
Pcdhga10	A	G	18: 37,749,256	Y690C	probably damaging	Het
Pdcd2	A	G	17: 15,527,081	Y65H	probably damaging	Het
Ppp1r12a	A	G	10: 108,240,837	E309G	probably benign	Het
Psmb8	A	G	17: 34,199,643	D123G	probably damaging	Het
Ptcd3	A	T	6: 71,885,315	W513R	probably damaging	Het
Ptx4	G	A	17: 25,124,924	V383I	possibly damaging	Het
Ric1	T	C	19: 29,586,613	L589S	probably damaging	Het
Rmnd5b	A	G	11: 51,624,600		probably benign	Het
Sec16a	A	T	2: 26,423,574	S1925T	probably damaging	Het
Slc16a11	T	A	11: 70,216,016	M360K	possibly damaging	Het
Slc2a6	G	T	2: 27,027,243	S45R	probably damaging	Het
Sppl3	T	A	5: 115,082,290	M87K	probably damaging	Het
Tbcel	A	T	9: 42,416,117	L330*	probably null	Het
Tbx5	A	T	5: 119,871,389	Y321F	possibly damaging	Het
Tenm3	C	T	8: 48,236,439	D2038N	probably damaging	Het
Tesk1	A	G	4: 43,447,006	T465A	probably benign	Het
Unc45a	A	T	7: 80,325,655	Y934N	probably damaging	Het
Unc80	A	T	1: 66,549,793	Q1039L	possibly damaging	Het
Vmn2r112	T	C	17: 22,603,214	L291P	probably benign	Het
Wwc2	A	T	8: 47,847,465	F988I	unknown	Het
Zfp947	G	A	17: 22,145,980	P238S	probably benign	Het

Other mutations in Slc19a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01464:Slc19a2	APN	1	164260861	missense	probably damaging	1.00
IGL03231:Slc19a2	APN	1	164260880	missense	probably damaging	1.00
R0324:Slc19a2	UTSW	1	164256775	missense	probably damaging	1.00
R0709:Slc19a2	UTSW	1	164256798	missense	probably damaging	1.00
R1117:Slc19a2	UTSW	1	164263456	missense	possibly damaging	0.86
R1165:Slc19a2	UTSW	1	164263445	missense	probably damaging	1.00
R1463:Slc19a2	UTSW	1	164257197	missense	probably damaging	0.98
R1833:Slc19a2	UTSW	1	164262184	missense	probably damaging	1.00
R2148:Slc19a2	UTSW	1	164262088	missense	probably damaging	1.00
R2680:Slc19a2	UTSW	1	164249413	missense	probably damaging	1.00
R4010:Slc19a2	UTSW	1	164260882	missense	probably damaging	1.00
R5850:Slc19a2	UTSW	1	164263456	missense	probably benign	0.00
R6279:Slc19a2	UTSW	1	164256775	missense	probably damaging	1.00
R6300:Slc19a2	UTSW	1	164256775	missense	probably damaging	1.00
R6907:Slc19a2	UTSW	1	164262754	missense	possibly damaging	0.79
R6917:Slc19a2	UTSW	1	164261009	missense	probably damaging	1.00
R6982:Slc19a2	UTSW	1	164256859	missense	possibly damaging	0.88
R7424:Slc19a2	UTSW	1	164260876	missense	probably benign	0.31
R7575:Slc19a2	UTSW	1	164257122	missense	probably damaging	1.00
R8193:Slc19a2	UTSW	1	164257225	missense	probably benign	0.13
R8831:Slc19a2	UTSW	1	164256874	missense	probably damaging	1.00
R9424:Slc19a2	UTSW	1	164249326	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTGTCTGCACAAGAGGATATAAAC -3'
(R):5'- ACCGCCATTGTAGATGTCAGC -3'

Sequencing Primer
(F):5'- AACTCAGAGTAGCTTCAGGGCTC -3'
(R):5'- CGCCATTGTAGATGTCAGCATTCTG -3'

Posted On

2019-05-13