Mutagenetix > Incidental Mutation

Incidental Mutation 'R6993:Malrd1'

543947

Institutional Source

Beutler Lab

Gene Symbol

Malrd1

Ensembl Gene

ENSMUSG00000075520

Gene Name

MAM and LDL receptor class A domain containing 1

Synonyms

Diet1, Gm13364, Gm13318

MMRRC Submission

045099-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R6993 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15526479-16255555 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 16150791 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 2004 (I2004L)

Ref Sequence

ENSEMBL: ENSMUSP00000116869 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000146205]

AlphaFold

A2AJX4

Predicted Effect

unknown
Transcript: ENSMUST00000146205
AA Change: I2004L

SMART Domains

Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: I2004L

Domain	Start	End	E-Value	Type
Pfam:MAM	8	171	1.6e-36	PFAM
LDLa	181	219	6.89e-8	SMART
LDLa	225	262	4.37e-10	SMART
LDLa	264	303	9.55e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (66/67)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	T	C	8: 79,248,424	E10G	possibly damaging	Het
Akap9	A	G	5: 4,065,866	I3429V	possibly damaging	Het
Braf	T	A	6: 39,643,163	I441F	probably damaging	Het
C5ar1	A	T	7: 16,248,912	V61E	probably damaging	Het
Camk2a	C	A	18: 60,943,175		probably benign	Het
Cd163	A	G	6: 124,317,714	Y579C	probably damaging	Het
Celf1	T	C	2: 91,010,476	Y363H	probably damaging	Het
Cntn3	T	C	6: 102,278,404	T178A	probably damaging	Het
Cryab	C	T	9: 50,753,448	P58S	probably benign	Het
Ctsf	G	T	19: 4,858,483	R290L	probably benign	Het
Ctsw	T	A	19: 5,465,837	I258F	probably damaging	Het
Dnah7b	T	C	1: 46,195,139		probably null	Het
Drg1	TCATCTTCCA	TCA	11: 3,250,294		probably null	Het
Etfb	A	G	7: 43,456,554	T172A	possibly damaging	Het
Etfdh	A	G	3: 79,612,031	Y272H	probably benign	Het
Ewsr1	C	T	11: 5,071,573	R454Q	probably benign	Het
F2rl2	T	A	13: 95,701,134	I229N	probably damaging	Het
Fam162a	A	T	16: 36,049,845	I88N	probably damaging	Het
Fastkd5	A	G	2: 130,616,539	S44P	probably benign	Het
Fat3	T	G	9: 15,919,221	S4326R	probably damaging	Het
Fbf1	T	C	11: 116,152,784	K400E	probably benign	Het
Fndc7	A	G	3: 108,876,591	V234A	probably benign	Het
Gfi1	T	A	5: 107,717,768	H481L	probably damaging	Het
Gm5591	T	A	7: 38,519,223	H742L	probably benign	Het
Gm5724	G	A	6: 141,765,742	T81I	possibly damaging	Het
Gm853	A	G	4: 130,218,313	L192P	probably damaging	Het
Golm1	ACTTCTTCT	ACTTCT	13: 59,649,576		probably benign	Het
H2-DMb1	A	C	17: 34,157,350	T148P	possibly damaging	Het
H2-T3	A	G	17: 36,187,070	L317P	probably damaging	Het
Hes3	T	C	4: 152,286,923	T190A	probably benign	Het
Hivep1	C	T	13: 42,158,714	L1477F	possibly damaging	Het
Insr	C	T	8: 3,258,752	G95S	probably damaging	Het
Irf9	A	G	14: 55,608,957	I394V	probably benign	Het
Kat2b	T	C	17: 53,638,522	L323P	probably damaging	Het
Kdr	T	C	5: 75,972,411	D69G	probably benign	Het
Krt2	C	T	15: 101,815,960	E290K	probably damaging	Het
Krtap4-6	G	T	11: 99,665,719	R61S	unknown	Het
Lrrc27	A	T	7: 139,242,624	K477M	probably damaging	Het
Lvrn	T	C	18: 46,882,298	V579A	probably benign	Het
Mast4	A	T	13: 102,735,974	N2103K	probably benign	Het
Mast4	C	T	13: 102,804,647	V301I	probably damaging	Het
Myo18a	T	A	11: 77,859,074		probably benign	Het
Olfr597	G	T	7: 103,320,791		probably benign	Het
Olfr975	T	A	9: 39,950,637	M45L	probably benign	Het
Pcdhga10	A	G	18: 37,749,256	Y690C	probably damaging	Het
Pdcd2	A	G	17: 15,527,081	Y65H	probably damaging	Het
Ppp1r12a	A	G	10: 108,240,837	E309G	probably benign	Het
Psmb8	A	G	17: 34,199,643	D123G	probably damaging	Het
Ptcd3	A	T	6: 71,885,315	W513R	probably damaging	Het
Ptx4	G	A	17: 25,124,924	V383I	possibly damaging	Het
Ric1	T	C	19: 29,586,613	L589S	probably damaging	Het
Rmnd5b	A	G	11: 51,624,600		probably benign	Het
Sec16a	A	T	2: 26,423,574	S1925T	probably damaging	Het
Slc16a11	T	A	11: 70,216,016	M360K	possibly damaging	Het
Slc19a2	T	A	1: 164,260,822	F79I	probably benign	Het
Slc2a6	G	T	2: 27,027,243	S45R	probably damaging	Het
Sppl3	T	A	5: 115,082,290	M87K	probably damaging	Het
Tbcel	A	T	9: 42,416,117	L330*	probably null	Het
Tbx5	A	T	5: 119,871,389	Y321F	possibly damaging	Het
Tenm3	C	T	8: 48,236,439	D2038N	probably damaging	Het
Tesk1	A	G	4: 43,447,006	T465A	probably benign	Het
Unc45a	A	T	7: 80,325,655	Y934N	probably damaging	Het
Unc80	A	T	1: 66,549,793	Q1039L	possibly damaging	Het
Vmn2r112	T	C	17: 22,603,214	L291P	probably benign	Het
Wwc2	A	T	8: 47,847,465	F988I	unknown	Het
Zfp947	G	A	17: 22,145,980	P238S	probably benign	Het

Other mutations in Malrd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Malrd1	APN	2	16142186	splice site	probably benign
IGL01295:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01296:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01399:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01400:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01401:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01402:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01405:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL01406:Malrd1	APN	2	16101957	critical splice donor site	probably null
IGL02105:Malrd1	APN	2	16127863	missense	unknown
IGL02581:Malrd1	APN	2	16142312	nonsense	probably null
IGL03015:Malrd1	APN	2	16042271	missense	unknown
IGL03038:Malrd1	APN	2	16127967	missense	unknown
R1353:Malrd1	UTSW	2	16127968	missense	unknown
R1385:Malrd1	UTSW	2	16042228	missense	unknown
R2242:Malrd1	UTSW	2	16101944	missense	unknown
R2888:Malrd1	UTSW	2	16074757	missense	unknown
R4398:Malrd1	UTSW	2	16150783	missense	unknown
R4982:Malrd1	UTSW	2	16042129	missense	probably benign	0.29
R5148:Malrd1	UTSW	2	16142226	missense	unknown
R5195:Malrd1	UTSW	2	16150810	missense	unknown
R5828:Malrd1	UTSW	2	15526653	missense	probably benign	0.00
R5892:Malrd1	UTSW	2	15614267	missense	probably benign	0.03
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6034:Malrd1	UTSW	2	15845326	missense	possibly damaging	0.78
R6195:Malrd1	UTSW	2	15695326	missense	probably damaging	1.00
R6318:Malrd1	UTSW	2	16042267	missense	unknown
R6438:Malrd1	UTSW	2	15614206	missense
R6457:Malrd1	UTSW	2	15526597	start gained	probably benign
R6457:Malrd1	UTSW	2	15667929	missense	probably benign	0.41
R6499:Malrd1	UTSW	2	15931689	missense	probably benign	0.03
R6575:Malrd1	UTSW	2	15842628	missense	probably benign	0.00
R6792:Malrd1	UTSW	2	16150756	missense	unknown
R6796:Malrd1	UTSW	2	15869784	missense	unknown
R6930:Malrd1	UTSW	2	15797667	missense	unknown
R6959:Malrd1	UTSW	2	16218009	missense	probably damaging	0.97
R7102:Malrd1	UTSW	2	16142303	missense	unknown
R7112:Malrd1	UTSW	2	15925176	missense	unknown
R7248:Malrd1	UTSW	2	16101911	missense	unknown
R7249:Malrd1	UTSW	2	15623340	missense	probably damaging	0.97
R7334:Malrd1	UTSW	2	16006718	missense	probably damaging	0.99
R7394:Malrd1	UTSW	2	15695199	missense	unknown
R7399:Malrd1	UTSW	2	15610090	missense
R7476:Malrd1	UTSW	2	16142304	missense	unknown
R7582:Malrd1	UTSW	2	15695270	missense	unknown
R7604:Malrd1	UTSW	2	15925192	missense	unknown
R7662:Malrd1	UTSW	2	15871454	missense	unknown
R7681:Malrd1	UTSW	2	16218102	missense	unknown
R7740:Malrd1	UTSW	2	15614215	missense	not run
R7747:Malrd1	UTSW	2	16074835	missense	unknown
R7754:Malrd1	UTSW	2	15797799	splice site	probably null
R7950:Malrd1	UTSW	2	16128068	missense	unknown
R8194:Malrd1	UTSW	2	15925120	missense	unknown
R8260:Malrd1	UTSW	2	15614206	missense
R8314:Malrd1	UTSW	2	15752832	missense	unknown
R8342:Malrd1	UTSW	2	15633224	missense	unknown
R8386:Malrd1	UTSW	2	15696844	missense	unknown
R8492:Malrd1	UTSW	2	15610123	missense
R8728:Malrd1	UTSW	2	15696942	nonsense	probably null
R8756:Malrd1	UTSW	2	15752895	critical splice donor site	probably null
R8869:Malrd1	UTSW	2	15565557	critical splice donor site	probably null
R8888:Malrd1	UTSW	2	15845227	missense	unknown
R8895:Malrd1	UTSW	2	15845227	missense	unknown
R8902:Malrd1	UTSW	2	16255334	nonsense	probably null
R8954:Malrd1	UTSW	2	15551367	missense
R8960:Malrd1	UTSW	2	15565430	nonsense	probably null
R9005:Malrd1	UTSW	2	15845329	missense	unknown
R9135:Malrd1	UTSW	2	15797705	missense	unknown
R9267:Malrd1	UTSW	2	16255266	missense	unknown
R9330:Malrd1	UTSW	2	16255278	missense	unknown
R9359:Malrd1	UTSW	2	15614177	missense
R9383:Malrd1	UTSW	2	15695201	missense	unknown
R9389:Malrd1	UTSW	2	15703156	missense	unknown
R9403:Malrd1	UTSW	2	15614177	missense
R9454:Malrd1	UTSW	2	15752849	missense	unknown
R9454:Malrd1	UTSW	2	15797726	nonsense	probably null
R9520:Malrd1	UTSW	2	16074820	missense	unknown
R9544:Malrd1	UTSW	2	15635998	missense	unknown
R9609:Malrd1	UTSW	2	15695270	missense	unknown
R9667:Malrd1	UTSW	2	15565215	critical splice acceptor site	probably null
R9721:Malrd1	UTSW	2	15696827	missense	unknown
R9787:Malrd1	UTSW	2	15620590	missense	unknown
R9800:Malrd1	UTSW	2	15842594	missense	unknown
Z1176:Malrd1	UTSW	2	16217845	missense	unknown
Z1191:Malrd1	UTSW	2	16042226	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACCATCTAGAACACCAGGGG -3'
(R):5'- CACGTGCTAGAAAATGTTGAAAACG -3'

Sequencing Primer
(F):5'- CCCTGGTCAGAGTGGAAGTG -3'
(R):5'- TGCAACAAACACCCAATATTTCTTG -3'

Posted On

2019-05-13