Incidental Mutation 'R6993:Etfdh'
ID543952
Institutional Source Beutler Lab
Gene Symbol Etfdh
Ensembl Gene ENSMUSG00000027809
Gene Nameelectron transferring flavoprotein, dehydrogenase
Synonyms0610010I20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6993 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location79603788-79629500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79612031 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 272 (Y272H)
Ref Sequence ENSEMBL: ENSMUSP00000113888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029386] [ENSMUST00000120992]
Predicted Effect probably benign
Transcript: ENSMUST00000029386
AA Change: Y332H

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029386
Gene: ENSMUSG00000027809
AA Change: Y332H

DomainStartEndE-ValueType
Pfam:Thi4 57 123 5.3e-9 PFAM
Pfam:FAD_binding_2 69 120 1.7e-7 PFAM
Pfam:Lycopene_cycl 69 125 5.7e-8 PFAM
Pfam:NAD_binding_8 72 122 9.7e-8 PFAM
Pfam:ETF_QO 511 614 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120992
AA Change: Y272H

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113888
Gene: ENSMUSG00000027809
AA Change: Y272H

DomainStartEndE-ValueType
Pfam:Thi4 1 63 2e-8 PFAM
Pfam:FAD_binding_2 9 59 4.7e-8 PFAM
Pfam:Pyr_redox_2 9 209 1.7e-7 PFAM
Pfam:NAD_binding_9 11 56 2.1e-7 PFAM
Pfam:NAD_binding_8 12 61 2.8e-8 PFAM
Pfam:ETF_QO 402 511 3e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the electron-transfer system in mitochondria and is essential for electron transfer from a number of mitochondrial flavin-containing dehydrogenases to the main respiratory chain. Mutations in this gene are associated with glutaric acidemia. Alternatively spliced transcript variants that encode distinct isoforms have been observed. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T C 8: 79,248,424 E10G possibly damaging Het
Akap9 A G 5: 4,065,866 I3429V possibly damaging Het
Braf T A 6: 39,643,163 I441F probably damaging Het
C5ar1 A T 7: 16,248,912 V61E probably damaging Het
Camk2a C A 18: 60,943,175 probably benign Het
Cd163 A G 6: 124,317,714 Y579C probably damaging Het
Celf1 T C 2: 91,010,476 Y363H probably damaging Het
Cntn3 T C 6: 102,278,404 T178A probably damaging Het
Cryab C T 9: 50,753,448 P58S probably benign Het
Ctsf G T 19: 4,858,483 R290L probably benign Het
Ctsw T A 19: 5,465,837 I258F probably damaging Het
Dnah7b T C 1: 46,195,139 probably null Het
Drg1 TCATCTTCCA TCA 11: 3,250,294 probably null Het
Etfb A G 7: 43,456,554 T172A possibly damaging Het
Ewsr1 C T 11: 5,071,573 R454Q probably benign Het
F2rl2 T A 13: 95,701,134 I229N probably damaging Het
Fam162a A T 16: 36,049,845 I88N probably damaging Het
Fastkd5 A G 2: 130,616,539 S44P probably benign Het
Fat3 T G 9: 15,919,221 S4326R probably damaging Het
Fbf1 T C 11: 116,152,784 K400E probably benign Het
Fndc7 A G 3: 108,876,591 V234A probably benign Het
Gfi1 T A 5: 107,717,768 H481L probably damaging Het
Gm5591 T A 7: 38,519,223 H742L probably benign Het
Gm5724 G A 6: 141,765,742 T81I possibly damaging Het
Gm853 A G 4: 130,218,313 L192P probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
H2-DMb1 A C 17: 34,157,350 T148P possibly damaging Het
H2-T3 A G 17: 36,187,070 L317P probably damaging Het
Hes3 T C 4: 152,286,923 T190A probably benign Het
Hivep1 C T 13: 42,158,714 L1477F possibly damaging Het
Insr C T 8: 3,258,752 G95S probably damaging Het
Irf9 A G 14: 55,608,957 I394V probably benign Het
Kat2b T C 17: 53,638,522 L323P probably damaging Het
Kdr T C 5: 75,972,411 D69G probably benign Het
Krt2 C T 15: 101,815,960 E290K probably damaging Het
Krtap4-6 G T 11: 99,665,719 R61S unknown Het
Lrrc27 A T 7: 139,242,624 K477M probably damaging Het
Lvrn T C 18: 46,882,298 V579A probably benign Het
Malrd1 A T 2: 16,150,791 I2004L unknown Het
Mast4 A T 13: 102,735,974 N2103K probably benign Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Myo18a T A 11: 77,859,074 probably benign Het
Olfr597 G T 7: 103,320,791 probably benign Het
Olfr975 T A 9: 39,950,637 M45L probably benign Het
Pcdhga10 A G 18: 37,749,256 Y690C probably damaging Het
Pdcd2 A G 17: 15,527,081 Y65H probably damaging Het
Ppp1r12a A G 10: 108,240,837 E309G probably benign Het
Psmb8 A G 17: 34,199,643 D123G probably damaging Het
Ptcd3 A T 6: 71,885,315 W513R probably damaging Het
Ptx4 G A 17: 25,124,924 V383I possibly damaging Het
Ric1 T C 19: 29,586,613 L589S probably damaging Het
Rmnd5b A G 11: 51,624,600 probably benign Het
Sec16a A T 2: 26,423,574 S1925T probably damaging Het
Slc16a11 T A 11: 70,216,016 M360K possibly damaging Het
Slc19a2 T A 1: 164,260,822 F79I probably benign Het
Slc2a6 G T 2: 27,027,243 S45R probably damaging Het
Sppl3 T A 5: 115,082,290 M87K probably damaging Het
Tbcel A T 9: 42,416,117 L330* probably null Het
Tbx5 A T 5: 119,871,389 Y321F possibly damaging Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Unc45a A T 7: 80,325,655 Y934N probably damaging Het
Unc80 A T 1: 66,549,793 Q1039L possibly damaging Het
Vmn2r112 T C 17: 22,603,214 L291P probably benign Het
Wwc2 A T 8: 47,847,465 F988I unknown Het
Zfp947 G A 17: 22,145,980 P238S probably benign Het
Other mutations in Etfdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Etfdh APN 3 79612061 splice site probably benign
IGL02231:Etfdh APN 3 79618393 missense probably damaging 1.00
IGL02414:Etfdh APN 3 79604096 missense probably damaging 0.99
IGL02816:Etfdh APN 3 79622805 missense probably damaging 1.00
PIT4142001:Etfdh UTSW 3 79609867 missense probably damaging 1.00
R0329:Etfdh UTSW 3 79609844 missense probably benign
R0555:Etfdh UTSW 3 79605805 missense probably benign 0.01
R2255:Etfdh UTSW 3 79604042 missense probably benign 0.10
R3040:Etfdh UTSW 3 79604919 missense probably damaging 1.00
R4035:Etfdh UTSW 3 79613711 missense probably benign 0.01
R4064:Etfdh UTSW 3 79605791 missense possibly damaging 0.90
R4693:Etfdh UTSW 3 79605803 missense probably damaging 0.97
R4995:Etfdh UTSW 3 79605788 missense probably benign 0.03
R5079:Etfdh UTSW 3 79618398 missense probably damaging 1.00
R5138:Etfdh UTSW 3 79623573 missense probably benign 0.31
R5756:Etfdh UTSW 3 79613756 missense probably benign
R5762:Etfdh UTSW 3 79615954 missense probably null 1.00
R5824:Etfdh UTSW 3 79609945 missense probably damaging 1.00
R5906:Etfdh UTSW 3 79604115 missense probably damaging 1.00
R6165:Etfdh UTSW 3 79604944 missense probably benign
R6185:Etfdh UTSW 3 79605807 missense probably benign 0.00
R6228:Etfdh UTSW 3 79612029 nonsense probably null
R7559:Etfdh UTSW 3 79623579 missense probably damaging 1.00
R7560:Etfdh UTSW 3 79623579 missense probably damaging 1.00
R7562:Etfdh UTSW 3 79623579 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTATACTGTAATTACTACGTTGTGC -3'
(R):5'- TCTGCCCTAGTAGTACTGTAATTTAG -3'

Sequencing Primer
(F):5'- TAGCAATTGAGAGTGGGT -3'
(R):5'- GTAGACCAGGCTGACTTTCAACTG -3'
Posted On2019-05-13