Incidental Mutation 'R6993:Braf'
ID543962
Institutional Source Beutler Lab
Gene Symbol Braf
Ensembl Gene ENSMUSG00000002413
Gene NameBraf transforming gene
SynonymsBraf-2, D6Ertd631e, 9930012E13Rik, Braf2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6993 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location39603237-39725463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39643163 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 441 (I441F)
Ref Sequence ENSEMBL: ENSMUSP00000099036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002487] [ENSMUST00000101497]
Predicted Effect probably damaging
Transcript: ENSMUST00000002487
AA Change: I494F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002487
Gene: ENSMUSG00000002413
AA Change: I494F

DomainStartEndE-ValueType
low complexity region 5 30 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
coiled coil region 94 121 N/A INTRINSIC
RBD 139 211 1.04e-33 SMART
C1 219 264 1.05e-13 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 316 326 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
Pfam:Pkinase_Tyr 494 751 9.6e-65 PFAM
Pfam:Pkinase 494 753 5.1e-60 PFAM
Pfam:Kinase-like 573 741 3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101497
AA Change: I441F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099036
Gene: ENSMUSG00000002413
AA Change: I441F

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
coiled coil region 60 88 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
RBD 138 210 1.04e-33 SMART
C1 218 263 1.05e-13 SMART
low complexity region 296 310 N/A INTRINSIC
low complexity region 315 325 N/A INTRINSIC
low complexity region 406 421 N/A INTRINSIC
Pfam:Pkinase 441 698 8.2e-62 PFAM
Pfam:Pkinase_Tyr 441 698 1.5e-65 PFAM
Pfam:Kinase-like 523 688 3.2e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the raf/mil family of serine/threonine protein kinases. This protein plays a role in regulating the MAP kinase/ERKs signaling pathway, which affects cell division, differentiation, and secretion. Mutations in this gene are associated with cardiofaciocutaneous syndrome, a disease characterized by heart defects, mental retardation and a distinctive facial appearance. Mutations in this gene have also been associated with various cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, thyroid carcinoma, non-small cell lung carcinoma, and adenocarcinoma of lung. A pseudogene, which is located on chromosome X, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die during organogenesis, are smaller, have enlarged blood vessels, hemorrhaging, poor circulation, slow heartbeat and abnormal endothelial cell development. Mice homozygous for a targeted allele activated in neurons exhibit impaired neuronal differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T C 8: 79,248,424 E10G possibly damaging Het
Akap9 A G 5: 4,065,866 I3429V possibly damaging Het
C5ar1 A T 7: 16,248,912 V61E probably damaging Het
Camk2a C A 18: 60,943,175 probably benign Het
Cd163 A G 6: 124,317,714 Y579C probably damaging Het
Celf1 T C 2: 91,010,476 Y363H probably damaging Het
Cntn3 T C 6: 102,278,404 T178A probably damaging Het
Cryab C T 9: 50,753,448 P58S probably benign Het
Ctsf G T 19: 4,858,483 R290L probably benign Het
Ctsw T A 19: 5,465,837 I258F probably damaging Het
Dnah7b T C 1: 46,195,139 probably null Het
Drg1 TCATCTTCCA TCA 11: 3,250,294 probably null Het
Etfb A G 7: 43,456,554 T172A possibly damaging Het
Etfdh A G 3: 79,612,031 Y272H probably benign Het
Ewsr1 C T 11: 5,071,573 R454Q probably benign Het
F2rl2 T A 13: 95,701,134 I229N probably damaging Het
Fam162a A T 16: 36,049,845 I88N probably damaging Het
Fastkd5 A G 2: 130,616,539 S44P probably benign Het
Fat3 T G 9: 15,919,221 S4326R probably damaging Het
Fbf1 T C 11: 116,152,784 K400E probably benign Het
Fndc7 A G 3: 108,876,591 V234A probably benign Het
Gfi1 T A 5: 107,717,768 H481L probably damaging Het
Gm5591 T A 7: 38,519,223 H742L probably benign Het
Gm5724 G A 6: 141,765,742 T81I possibly damaging Het
Gm853 A G 4: 130,218,313 L192P probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
H2-DMb1 A C 17: 34,157,350 T148P possibly damaging Het
H2-T3 A G 17: 36,187,070 L317P probably damaging Het
Hes3 T C 4: 152,286,923 T190A probably benign Het
Hivep1 C T 13: 42,158,714 L1477F possibly damaging Het
Insr C T 8: 3,258,752 G95S probably damaging Het
Irf9 A G 14: 55,608,957 I394V probably benign Het
Kat2b T C 17: 53,638,522 L323P probably damaging Het
Kdr T C 5: 75,972,411 D69G probably benign Het
Krt2 C T 15: 101,815,960 E290K probably damaging Het
Krtap4-6 G T 11: 99,665,719 R61S unknown Het
Lrrc27 A T 7: 139,242,624 K477M probably damaging Het
Lvrn T C 18: 46,882,298 V579A probably benign Het
Malrd1 A T 2: 16,150,791 I2004L unknown Het
Mast4 A T 13: 102,735,974 N2103K probably benign Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Myo18a T A 11: 77,859,074 probably benign Het
Olfr597 G T 7: 103,320,791 probably benign Het
Olfr975 T A 9: 39,950,637 M45L probably benign Het
Pcdhga10 A G 18: 37,749,256 Y690C probably damaging Het
Pdcd2 A G 17: 15,527,081 Y65H probably damaging Het
Ppp1r12a A G 10: 108,240,837 E309G probably benign Het
Psmb8 A G 17: 34,199,643 D123G probably damaging Het
Ptcd3 A T 6: 71,885,315 W513R probably damaging Het
Ptx4 G A 17: 25,124,924 V383I possibly damaging Het
Ric1 T C 19: 29,586,613 L589S probably damaging Het
Rmnd5b A G 11: 51,624,600 probably benign Het
Sec16a A T 2: 26,423,574 S1925T probably damaging Het
Slc16a11 T A 11: 70,216,016 M360K possibly damaging Het
Slc19a2 T A 1: 164,260,822 F79I probably benign Het
Slc2a6 G T 2: 27,027,243 S45R probably damaging Het
Sppl3 T A 5: 115,082,290 M87K probably damaging Het
Tbcel A T 9: 42,416,117 L330* probably null Het
Tbx5 A T 5: 119,871,389 Y321F possibly damaging Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Unc45a A T 7: 80,325,655 Y934N probably damaging Het
Unc80 A T 1: 66,549,793 Q1039L possibly damaging Het
Vmn2r112 T C 17: 22,603,214 L291P probably benign Het
Wwc2 A T 8: 47,847,465 F988I unknown Het
Zfp947 G A 17: 22,145,980 P238S probably benign Het
Other mutations in Braf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Braf APN 6 39660999 splice site probably null
IGL01616:Braf APN 6 39651652 missense probably damaging 1.00
IGL01621:Braf APN 6 39646853 intron probably benign
IGL01825:Braf APN 6 39639590 missense probably damaging 0.99
IGL02435:Braf APN 6 39646766 missense probably benign 0.00
IGL02629:Braf APN 6 39688299 missense possibly damaging 0.83
IGL02751:Braf APN 6 39660867 splice site probably benign
IGL02829:Braf APN 6 39627728 missense possibly damaging 0.62
R0041:Braf UTSW 6 39640479 missense probably damaging 1.00
R0041:Braf UTSW 6 39640479 missense probably damaging 1.00
R0497:Braf UTSW 6 39640549 splice site probably benign
R0512:Braf UTSW 6 39664989 splice site probably benign
R0604:Braf UTSW 6 39623697 missense probably damaging 1.00
R0726:Braf UTSW 6 39662148 missense possibly damaging 0.90
R1468:Braf UTSW 6 39665083 missense probably damaging 1.00
R1468:Braf UTSW 6 39665083 missense probably damaging 1.00
R1616:Braf UTSW 6 39643133 missense probably benign 0.35
R2160:Braf UTSW 6 39662073 missense probably damaging 1.00
R3722:Braf UTSW 6 39623676 missense probably damaging 1.00
R4407:Braf UTSW 6 39615720 missense probably damaging 1.00
R4540:Braf UTSW 6 39644333 missense probably damaging 1.00
R5026:Braf UTSW 6 39688287 missense probably benign 0.22
R5478:Braf UTSW 6 39677574 missense possibly damaging 0.94
R6284:Braf UTSW 6 39688282 missense possibly damaging 0.73
R7251:Braf UTSW 6 39677570 critical splice donor site probably null
R7385:Braf UTSW 6 39665108 critical splice acceptor site probably null
R7483:Braf UTSW 6 39627838 missense possibly damaging 0.86
R7511:Braf UTSW 6 39688253 missense probably damaging 0.99
Z1088:Braf UTSW 6 39662026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTCCTGCATTTGATGAAAAC -3'
(R):5'- AGAAGACCTTGCTCTGTTCC -3'

Sequencing Primer
(F):5'- AAGACAGATCTGTGTAGCCCTGTC -3'
(R):5'- CCTAACTTCCTGTCAGGCAG -3'
Posted On2019-05-13