Incidental Mutation 'R6993:F2rl2'
ID543991
Institutional Source Beutler Lab
Gene Symbol F2rl2
Ensembl Gene ENSMUSG00000021675
Gene Namecoagulation factor II (thrombin) receptor-like 2
SynonymsPAR3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6993 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location95696853-95702739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95701134 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 229 (I229N)
Ref Sequence ENSEMBL: ENSMUSP00000022182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022182] [ENSMUST00000068603]
PDB Structure
Crystal structure of murine thrombin in complex with the extracellular fragment of murine PAR3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000022182
AA Change: I229N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022182
Gene: ENSMUSG00000021675
AA Change: I229N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:7tm_1 110 295 1.7e-32 PFAM
Pfam:7tm_1 297 357 1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068603
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protease-activated receptor (PAR) family which is a subfamily of the seven transmembrane G protein-coupled cell surface receptor family. The encoded protein acts as a cofactor in the thrombin-mediated cleavage and activation of the protease-activated receptor family member PAR4. The encoded protein plays an essential role in hemostasis and thrombosis. Alternate splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in prolonged bleeding times, delayed and reduced thrombin responses in platelets, and protection against thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T C 8: 79,248,424 E10G possibly damaging Het
Akap9 A G 5: 4,065,866 I3429V possibly damaging Het
Braf T A 6: 39,643,163 I441F probably damaging Het
C5ar1 A T 7: 16,248,912 V61E probably damaging Het
Camk2a C A 18: 60,943,175 probably benign Het
Cd163 A G 6: 124,317,714 Y579C probably damaging Het
Celf1 T C 2: 91,010,476 Y363H probably damaging Het
Cntn3 T C 6: 102,278,404 T178A probably damaging Het
Cryab C T 9: 50,753,448 P58S probably benign Het
Ctsf G T 19: 4,858,483 R290L probably benign Het
Ctsw T A 19: 5,465,837 I258F probably damaging Het
Dnah7b T C 1: 46,195,139 probably null Het
Drg1 TCATCTTCCA TCA 11: 3,250,294 probably null Het
Etfb A G 7: 43,456,554 T172A possibly damaging Het
Etfdh A G 3: 79,612,031 Y272H probably benign Het
Ewsr1 C T 11: 5,071,573 R454Q probably benign Het
Fam162a A T 16: 36,049,845 I88N probably damaging Het
Fastkd5 A G 2: 130,616,539 S44P probably benign Het
Fat3 T G 9: 15,919,221 S4326R probably damaging Het
Fbf1 T C 11: 116,152,784 K400E probably benign Het
Fndc7 A G 3: 108,876,591 V234A probably benign Het
Gfi1 T A 5: 107,717,768 H481L probably damaging Het
Gm5591 T A 7: 38,519,223 H742L probably benign Het
Gm5724 G A 6: 141,765,742 T81I possibly damaging Het
Gm853 A G 4: 130,218,313 L192P probably damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
H2-DMb1 A C 17: 34,157,350 T148P possibly damaging Het
H2-T3 A G 17: 36,187,070 L317P probably damaging Het
Hes3 T C 4: 152,286,923 T190A probably benign Het
Hivep1 C T 13: 42,158,714 L1477F possibly damaging Het
Insr C T 8: 3,258,752 G95S probably damaging Het
Irf9 A G 14: 55,608,957 I394V probably benign Het
Kat2b T C 17: 53,638,522 L323P probably damaging Het
Kdr T C 5: 75,972,411 D69G probably benign Het
Krt2 C T 15: 101,815,960 E290K probably damaging Het
Krtap4-6 G T 11: 99,665,719 R61S unknown Het
Lrrc27 A T 7: 139,242,624 K477M probably damaging Het
Lvrn T C 18: 46,882,298 V579A probably benign Het
Malrd1 A T 2: 16,150,791 I2004L unknown Het
Mast4 A T 13: 102,735,974 N2103K probably benign Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Myo18a T A 11: 77,859,074 probably benign Het
Olfr597 G T 7: 103,320,791 probably benign Het
Olfr975 T A 9: 39,950,637 M45L probably benign Het
Pcdhga10 A G 18: 37,749,256 Y690C probably damaging Het
Pdcd2 A G 17: 15,527,081 Y65H probably damaging Het
Ppp1r12a A G 10: 108,240,837 E309G probably benign Het
Psmb8 A G 17: 34,199,643 D123G probably damaging Het
Ptcd3 A T 6: 71,885,315 W513R probably damaging Het
Ptx4 G A 17: 25,124,924 V383I possibly damaging Het
Ric1 T C 19: 29,586,613 L589S probably damaging Het
Rmnd5b A G 11: 51,624,600 probably benign Het
Sec16a A T 2: 26,423,574 S1925T probably damaging Het
Slc16a11 T A 11: 70,216,016 M360K possibly damaging Het
Slc19a2 T A 1: 164,260,822 F79I probably benign Het
Slc2a6 G T 2: 27,027,243 S45R probably damaging Het
Sppl3 T A 5: 115,082,290 M87K probably damaging Het
Tbcel A T 9: 42,416,117 L330* probably null Het
Tbx5 A T 5: 119,871,389 Y321F possibly damaging Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Unc45a A T 7: 80,325,655 Y934N probably damaging Het
Unc80 A T 1: 66,549,793 Q1039L possibly damaging Het
Vmn2r112 T C 17: 22,603,214 L291P probably benign Het
Wwc2 A T 8: 47,847,465 F988I unknown Het
Zfp947 G A 17: 22,145,980 P238S probably benign Het
Other mutations in F2rl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:F2rl2 APN 13 95701328 missense probably benign 0.00
R0014:F2rl2 UTSW 13 95700909 missense probably damaging 0.99
R0014:F2rl2 UTSW 13 95700909 missense probably damaging 0.99
R0969:F2rl2 UTSW 13 95700953 missense probably damaging 1.00
R1183:F2rl2 UTSW 13 95701113 missense probably damaging 0.96
R1482:F2rl2 UTSW 13 95701539 missense probably benign 0.02
R1753:F2rl2 UTSW 13 95701461 missense probably benign 0.16
R2428:F2rl2 UTSW 13 95697077 missense possibly damaging 0.75
R3151:F2rl2 UTSW 13 95701130 missense probably benign 0.00
R4678:F2rl2 UTSW 13 95700632 missense probably benign 0.10
R5153:F2rl2 UTSW 13 95697112 missense probably benign 0.00
R5229:F2rl2 UTSW 13 95700687 missense possibly damaging 0.93
R5635:F2rl2 UTSW 13 95700782 missense possibly damaging 0.88
R6041:F2rl2 UTSW 13 95701109 missense probably benign 0.01
R6146:F2rl2 UTSW 13 95700641 missense probably benign 0.08
R6974:F2rl2 UTSW 13 95700530 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGATCACCACGGTTGTTTTCTAC -3'
(R):5'- ATGTAGCCCAGCCATATCCG -3'

Sequencing Primer
(F):5'- TCTACGGCAACATGTACTGCG -3'
(R):5'- GCCATATCCGATCCTTTGATTTAAG -3'
Posted On2019-05-13