Incidental Mutation 'R0608:Plcz1'
ID 54401
Institutional Source Beutler Lab
Gene Symbol Plcz1
Ensembl Gene ENSMUSG00000030230
Gene Name phospholipase C, zeta 1
Synonyms 1700041H07Rik
MMRRC Submission 038797-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0608 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 139989673-140041457 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 139990733 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 590 (R590H)
Ref Sequence ENSEMBL: ENSMUSP00000032356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032356] [ENSMUST00000129986] [ENSMUST00000137148]
AlphaFold Q8K4D7
Predicted Effect probably damaging
Transcript: ENSMUST00000032356
AA Change: R590H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032356
Gene: ENSMUSG00000030230
AA Change: R590H

DomainStartEndE-ValueType
Pfam:EF-hand_like 80 162 9.6e-26 PFAM
PLCXc 163 307 5.17e-72 SMART
low complexity region 374 385 N/A INTRINSIC
PLCYc 386 502 1.52e-51 SMART
C2 521 625 2.06e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129986
Predicted Effect probably benign
Transcript: ENSMUST00000137148
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the phosphoinositide-specific phospholipase C family. Members in this family, classified into six isotypes that are tissue- and organ-specific, hydrolyze phosphatidylinositol 4,5-bisphosphate just before the phosphate group to yield diacylglycerol and inositol 1,4,5-trisphosphate. This protein localizes to the acrosome in spermatozoa and elicits Ca(2+) oscillations and egg activation during fertilization that leads to early embryonic development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous knockout mice display normal spermatogenesis and sperm motility but are sub-fertile because of a failure to induce Ca2+ oscillations in oocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik A G 18: 59,062,459 probably null Het
Akap11 A G 14: 78,510,753 V1398A probably benign Het
Ampd3 C A 7: 110,795,790 D315E probably damaging Het
Ampd3 T A 7: 110,795,791 F316I probably damaging Het
Arhgef40 A C 14: 51,996,974 E911D probably damaging Het
Atxn2l A G 7: 126,501,416 probably null Het
BC117090 T C 16: 36,323,024 probably null Het
Bckdhb T G 9: 83,953,736 F98V probably damaging Het
Calhm1 C T 19: 47,143,841 V112I probably benign Het
Ccdc28a G A 10: 18,224,951 R90C probably damaging Het
Cdc40 A T 10: 40,848,052 Y247N probably benign Het
Cds1 G A 5: 101,814,433 V305M probably damaging Het
Cep128 T G 12: 90,999,535 probably benign Het
Cep72 A T 13: 74,038,304 H249Q probably damaging Het
Cfap70 A T 14: 20,448,563 Y19N probably damaging Het
Col11a1 T C 3: 114,218,715 probably benign Het
Cysltr1 A G X: 106,578,655 V75A possibly damaging Het
Dnah17 G T 11: 118,090,749 Y1716* probably null Het
Dnm1 T C 2: 32,335,824 E383G possibly damaging Het
Dst C A 1: 34,290,356 probably null Het
Edil3 T C 13: 89,184,849 S375P probably damaging Het
Eme1 A G 11: 94,650,082 C277R probably damaging Het
Enam T C 5: 88,493,027 W183R possibly damaging Het
Fbxl6 C T 15: 76,536,753 V341M probably benign Het
Fgf14 A G 14: 124,676,603 S39P probably damaging Het
Fmo4 C T 1: 162,803,651 R249H possibly damaging Het
Gle1 T A 2: 29,940,228 D265E probably benign Het
Gml2 T C 15: 74,821,386 probably null Het
Golgb1 G T 16: 36,916,330 E1980* probably null Het
Hap1 A G 11: 100,349,305 L555P probably damaging Het
Heca T C 10: 17,915,291 D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 T101A possibly damaging Het
Ift88 T C 14: 57,496,221 V707A probably benign Het
Kdm3a C T 6: 71,620,046 G252D probably benign Het
Klhl11 A G 11: 100,472,242 Y163H probably damaging Het
Kntc1 A T 5: 123,786,074 N1008Y probably damaging Het
Lrp2 G T 2: 69,486,243 N2131K probably benign Het
Lrrc6 T A 15: 66,380,474 M448L probably benign Het
Magi3 C G 3: 104,017,557 G1092A probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrps26 G T 2: 130,563,858 R27L possibly damaging Het
Myof T C 19: 37,916,504 D1624G probably damaging Het
Naif1 T C 2: 32,454,896 M204T probably benign Het
Ndufb8 T C 19: 44,550,345 E179G possibly damaging Het
Neb A T 2: 52,326,757 D135E probably benign Het
Nlrp6 C T 7: 140,923,486 Q502* probably null Het
Nploc4 A G 11: 120,413,681 L238P probably damaging Het
Olfr463 G A 11: 87,893,196 H243Y probably damaging Het
Parp4 T A 14: 56,602,404 V523E probably damaging Het
Pdgfra T C 5: 75,163,777 Y98H probably damaging Het
Pnliprp1 T A 19: 58,738,196 Y328* probably null Het
Pnpla8 C T 12: 44,283,463 P48L probably benign Het
Rab44 T A 17: 29,147,343 probably null Het
Ranbp2 T C 10: 58,493,898 I3031T probably damaging Het
Rnf219 T C 14: 104,479,527 Y470C probably damaging Het
Sbno1 T C 5: 124,384,541 D1072G probably damaging Het
Senp7 A G 16: 56,123,873 T187A possibly damaging Het
Serpinh1 A G 7: 99,349,394 C10R unknown Het
Sh2d4a A G 8: 68,346,694 Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 D23G probably benign Het
Slc7a7 A G 14: 54,377,802 L246P probably damaging Het
Spire1 T C 18: 67,528,875 R163G probably damaging Het
Stxbp2 T A 8: 3,632,559 D49E probably damaging Het
Susd2 C T 10: 75,638,235 A509T probably benign Het
Sycp2 A G 2: 178,382,404 F396L probably damaging Het
Syne2 T C 12: 75,963,813 L2499P probably damaging Het
Syt10 C A 15: 89,826,941 A130S probably benign Het
Sytl4 A T X: 133,962,187 D16E probably benign Het
Tab2 C T 10: 7,920,119 V126I probably damaging Het
Tecpr1 T C 5: 144,211,499 T363A probably damaging Het
Terb2 A G 2: 122,186,335 D16G probably benign Het
Tm2d2 A G 8: 25,020,536 E137G probably benign Het
Trim30d T A 7: 104,472,485 H201L probably damaging Het
Tspan3 A G 9: 56,147,385 probably null Het
Ttn A T 2: 76,787,323 L16268Q probably damaging Het
Ttn A T 2: 76,796,185 probably null Het
Ubap2 T A 4: 41,218,319 T263S probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Zeb2 A T 2: 44,996,126 M973K possibly damaging Het
Zfp229 A G 17: 21,746,634 E615G probably damaging Het
Zfp655 T A 5: 145,244,057 S242T possibly damaging Het
Zfp788 T A 7: 41,648,281 F62I possibly damaging Het
Zmynd8 A G 2: 165,787,158 probably null Het
Other mutations in Plcz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Plcz1 APN 6 140002256 splice site probably benign
IGL01825:Plcz1 APN 6 140003916 missense probably benign 0.03
IGL01885:Plcz1 APN 6 140002111 missense probably benign 0.14
IGL02539:Plcz1 APN 6 139992964 missense probably benign 0.06
IGL02754:Plcz1 APN 6 140010581 missense probably benign 0.00
IGL03379:Plcz1 APN 6 139990764 missense possibly damaging 0.69
IGL03412:Plcz1 APN 6 140016097 missense probably damaging 0.99
helium UTSW 6 140016127 missense probably damaging 1.00
R0005:Plcz1 UTSW 6 140040564 splice site probably benign
R0034:Plcz1 UTSW 6 140020448 utr 3 prime probably benign
R0078:Plcz1 UTSW 6 139989784 missense probably damaging 1.00
R0142:Plcz1 UTSW 6 140007697 missense probably damaging 1.00
R0200:Plcz1 UTSW 6 139990733 missense probably damaging 1.00
R0399:Plcz1 UTSW 6 140023230 missense possibly damaging 0.95
R0599:Plcz1 UTSW 6 140028542 missense probably benign
R1854:Plcz1 UTSW 6 139993049 missense probably benign 0.36
R2212:Plcz1 UTSW 6 140002081 missense probably damaging 0.98
R2895:Plcz1 UTSW 6 140023151 missense possibly damaging 0.79
R3413:Plcz1 UTSW 6 140002081 missense probably damaging 0.98
R4239:Plcz1 UTSW 6 140040618 splice site probably null
R4441:Plcz1 UTSW 6 139990687 missense probably benign 0.00
R4889:Plcz1 UTSW 6 140007748 missense probably benign 0.00
R4953:Plcz1 UTSW 6 140028551 missense possibly damaging 0.89
R5175:Plcz1 UTSW 6 140039663 missense possibly damaging 0.94
R5359:Plcz1 UTSW 6 140028452 missense probably damaging 1.00
R5401:Plcz1 UTSW 6 139993052 splice site probably null
R5505:Plcz1 UTSW 6 140016216 missense probably damaging 0.99
R5558:Plcz1 UTSW 6 140039755 missense probably damaging 1.00
R5581:Plcz1 UTSW 6 140023125 missense probably damaging 1.00
R6252:Plcz1 UTSW 6 140007603 critical splice donor site probably null
R6569:Plcz1 UTSW 6 140007707 missense possibly damaging 0.62
R6750:Plcz1 UTSW 6 140028438 missense possibly damaging 0.74
R7073:Plcz1 UTSW 6 140023123 nonsense probably null
R7204:Plcz1 UTSW 6 140010424 missense probably benign 0.05
R7309:Plcz1 UTSW 6 140023156 missense probably damaging 1.00
R7446:Plcz1 UTSW 6 140013586 missense possibly damaging 0.63
R7503:Plcz1 UTSW 6 139990748 missense probably damaging 1.00
R7634:Plcz1 UTSW 6 140016127 missense probably damaging 1.00
R8192:Plcz1 UTSW 6 140023260 missense probably damaging 1.00
R8302:Plcz1 UTSW 6 140028437 missense probably damaging 1.00
R8679:Plcz1 UTSW 6 140003886 missense probably damaging 1.00
R8985:Plcz1 UTSW 6 140016177 missense possibly damaging 0.79
R9052:Plcz1 UTSW 6 140023179 missense probably damaging 1.00
R9203:Plcz1 UTSW 6 140007755 nonsense probably null
R9336:Plcz1 UTSW 6 140039720 missense possibly damaging 0.86
R9598:Plcz1 UTSW 6 140039758 missense possibly damaging 0.87
R9779:Plcz1 UTSW 6 140002156 missense possibly damaging 0.80
Z1176:Plcz1 UTSW 6 140013676 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GTTTCCCTTAGCAGCCCAGCATAC -3'
(R):5'- TGTAGTTTCCTGGCTTGTGAACCC -3'

Sequencing Primer
(F):5'- CAGAAAGAACATGTCTCTGCTG -3'
(R):5'- CTGGCTTGTGAACCCTGTTG -3'
Posted On 2013-07-11