Incidental Mutation 'R6994:Ubr1'
ID544020
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Nameubiquitin protein ligase E3 component n-recognin 1
SynonymsE3 alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.733) question?
Stock #R6994 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120860269-120970715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120963593 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 37 (T37A)
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
Predicted Effect probably benign
Transcript: ENSMUST00000028728
AA Change: T37A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: T37A

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T G 4: 144,623,279 W369G probably damaging Het
Abhd16b C T 2: 181,493,668 T121M possibly damaging Het
Adam5 A T 8: 24,786,246 C468* probably null Het
Aim2 C T 1: 173,455,586 A78V possibly damaging Het
Alg9 G A 9: 50,792,122 W254* probably null Het
Ankrd55 G C 13: 112,368,300 E499Q probably benign Het
Atp6v0a2 T C 5: 124,714,145 F546S probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Bpi A T 2: 158,258,244 probably benign Het
Bves A G 10: 45,339,418 H63R probably benign Het
Ccdc183 T C 2: 25,617,045 M45V probably benign Het
Cmklr1 T C 5: 113,614,922 Y6C probably damaging Het
Colgalt1 C T 8: 71,623,521 R539C probably damaging Het
Ctsm T A 13: 61,539,884 E53D probably damaging Het
Cyp2a22 A G 7: 26,939,181 probably null Het
Ddx10 A G 9: 53,204,111 V641A probably damaging Het
Ddx6 T C 9: 44,628,723 V316A probably damaging Het
Dhx34 T C 7: 16,203,874 D767G probably benign Het
Dtnbp1 T A 13: 45,001,929 D15V probably damaging Het
Dtx3l C T 16: 35,931,372 probably null Het
Entpd8 T C 2: 25,083,309 I162T probably damaging Het
Fam186a G T 15: 99,942,466 Q1966K probably benign Het
Fbxo27 A C 7: 28,693,360 D22A probably damaging Het
Fermt3 A T 19: 6,999,727 I577N probably damaging Het
Frmd8 A T 19: 5,873,181 S81T probably damaging Het
Gm4788 T A 1: 139,736,930 I464L possibly damaging Het
Gm5108 T A 5: 67,944,669 probably benign Het
Gm9195 T C 14: 72,480,831 Y135C probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
H2afy T C 13: 56,089,830 N206D probably benign Het
Kcnh8 A T 17: 52,977,695 I898F probably benign Het
Kri1 C T 9: 21,287,787 probably benign Het
Krt32 T A 11: 100,086,445 I210F probably damaging Het
Lama1 G A 17: 67,753,825 C716Y Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Lpin3 C T 2: 160,904,883 P766L probably damaging Het
Marf1 T C 16: 14,128,857 T1169A probably damaging Het
Morc1 G A 16: 48,565,621 V536M probably benign Het
Morc1 A T 16: 48,618,546 H768L probably benign Het
Mpped2 T A 2: 106,699,533 H42Q possibly damaging Het
Nfatc1 G T 18: 80,653,564 probably null Het
Nfkbid G A 7: 30,425,767 S263N probably benign Het
Npas3 C A 12: 54,068,793 Q802K probably damaging Het
Olfr202 T G 16: 59,284,090 M136L possibly damaging Het
Olfr492 T A 7: 108,322,894 I261F possibly damaging Het
Olfr591 T C 7: 103,172,912 T242A probably damaging Het
Pabpc4l C A 3: 46,446,910 V100L possibly damaging Het
Pagr1a A G 7: 127,016,441 probably null Het
Pcdh1 A T 18: 38,198,500 N483K probably damaging Het
Pih1d3 T C 1: 31,222,909 probably benign Het
Pikfyve C A 1: 65,252,530 P1303T probably damaging Het
Plekhh3 T A 11: 101,165,693 probably null Het
Pnkd T A 1: 74,293,176 probably null Het
Pparg A T 6: 115,451,050 Q166L probably benign Het
Psenen A G 7: 30,563,507 probably null Het
Rab4a T C 8: 123,830,366 S142P probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Relt A C 7: 100,853,114 probably benign Het
Rftn1 T A 17: 50,036,991 T90S possibly damaging Het
Ripor3 T G 2: 167,997,266 D105A probably damaging Het
Rnase10 T A 14: 51,009,681 I135N probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rttn A G 18: 89,028,899 E895G probably damaging Het
Serpina3a G A 12: 104,112,830 probably null Het
Slco5a1 C T 1: 12,881,393 C562Y probably damaging Het
Spen T C 4: 141,493,459 T396A unknown Het
Tgfbr3 A G 5: 107,133,026 S623P probably damaging Het
Tmem8b A G 4: 43,690,192 I876V probably damaging Het
Tmod3 T C 9: 75,509,387 K221R probably damaging Het
Tomm40 G T 7: 19,702,906 D40E probably damaging Het
Trav6d-4 G T 14: 52,753,591 G28V probably damaging Het
Trav8d-2 G T 14: 53,042,476 A17S probably benign Het
Triml2 T C 8: 43,190,078 C158R possibly damaging Het
Trip10 A G 17: 57,255,331 E283G probably damaging Het
Tubb2b T C 13: 34,127,535 Y425C probably damaging Het
Unc13b A G 4: 43,171,403 probably benign Het
Unc13b A G 4: 43,173,203 probably benign Het
Vcan A T 13: 89,693,407 D379E possibly damaging Het
Vmn1r44 T A 6: 89,894,158 H295Q probably benign Het
Vmn2r16 A T 5: 109,340,103 S281C probably damaging Het
Vmn2r84 C T 10: 130,391,007 A321T possibly damaging Het
Vsig10l A T 7: 43,465,067 H271L possibly damaging Het
Vwa8 A T 14: 78,908,156 H91L possibly damaging Het
Zfp957 T A 14: 79,213,690 E223V probably damaging Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120875407 missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120941093 missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120930872 missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120914905 missense probably benign
IGL01346:Ubr1 APN 2 120873122 critical splice donor site probably null
IGL01368:Ubr1 APN 2 120941131 splice site probably benign
IGL01539:Ubr1 APN 2 120926013 missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120934342 missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120875398 missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120921386 missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120900508 missense probably benign 0.00
IGL02208:Ubr1 APN 2 120946349 missense probably benign 0.00
IGL02415:Ubr1 APN 2 120970603 utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120864373 missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120870979 splice site probably benign
IGL02627:Ubr1 APN 2 120940991 missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120914883 missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120941091 missense probably benign 0.01
IGL02939:Ubr1 APN 2 120881183 critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120961156 missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120864417 missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120895160 missense probably benign
I1329:Ubr1 UTSW 2 120934294 splice site probably benign
R0022:Ubr1 UTSW 2 120961173 splice site probably benign
R0345:Ubr1 UTSW 2 120904103 synonymous probably null
R0373:Ubr1 UTSW 2 120946657 missense probably benign 0.01
R0393:Ubr1 UTSW 2 120906946 missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120881093 missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120947883 nonsense probably null
R0723:Ubr1 UTSW 2 120881101 nonsense probably null
R1178:Ubr1 UTSW 2 120926029 nonsense probably null
R1401:Ubr1 UTSW 2 120955644 missense probably benign 0.01
R1485:Ubr1 UTSW 2 120961098 missense probably benign 0.03
R1572:Ubr1 UTSW 2 120935319 splice site probably benign
R1920:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1921:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1997:Ubr1 UTSW 2 120946273 critical splice donor site probably null
R2129:Ubr1 UTSW 2 120942553 missense probably benign 0.35
R2147:Ubr1 UTSW 2 120864330 missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120926047 missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120909482 missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120963448 missense probably benign 0.02
R3930:Ubr1 UTSW 2 120916470 missense probably benign 0.20
R3979:Ubr1 UTSW 2 120862687 missense probably benign 0.11
R4172:Ubr1 UTSW 2 120946622 splice site probably null
R4173:Ubr1 UTSW 2 120946622 splice site probably null
R4174:Ubr1 UTSW 2 120946622 splice site probably null
R4241:Ubr1 UTSW 2 120934386 missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120970603 utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120895066 splice site probably null
R4449:Ubr1 UTSW 2 120946381 missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120942482 missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120926013 missense probably benign 0.35
R4765:Ubr1 UTSW 2 120963442 nonsense probably null
R4928:Ubr1 UTSW 2 120914938 missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120963566 missense probably benign 0.00
R5033:Ubr1 UTSW 2 120911997 critical splice donor site probably null
R5108:Ubr1 UTSW 2 120963422 missense probably benign 0.20
R5118:Ubr1 UTSW 2 120882264 missense probably benign 0.20
R5211:Ubr1 UTSW 2 120893170 missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120904044 missense probably benign 0.00
R5449:Ubr1 UTSW 2 120963500 missense probably benign
R5452:Ubr1 UTSW 2 120868302 missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120915407 missense probably benign
R5610:Ubr1 UTSW 2 120892112 missense probably benign 0.04
R5637:Ubr1 UTSW 2 120963517 missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120961092 missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120904005 missense probably benign
R5979:Ubr1 UTSW 2 120946382 missense probably benign 0.07
R6044:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R6146:Ubr1 UTSW 2 120893209 missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120906895 missense probably benign 0.21
R6389:Ubr1 UTSW 2 120881039 missense probably benign 0.03
R6600:Ubr1 UTSW 2 120915399 missense probably benign 0.00
R6670:Ubr1 UTSW 2 120924130 critical splice donor site probably null
R6731:Ubr1 UTSW 2 120955640 missense probably null 0.99
R6836:Ubr1 UTSW 2 120896675 intron probably null
R7121:Ubr1 UTSW 2 120875498 missense probably benign 0.00
R7204:Ubr1 UTSW 2 120904077 missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120862765 missense probably benign 0.04
R7434:Ubr1 UTSW 2 120862680 missense probably benign
R7457:Ubr1 UTSW 2 120917828 missense probably benign 0.35
R7464:Ubr1 UTSW 2 120889774 critical splice donor site probably null
R7519:Ubr1 UTSW 2 120875444 missense possibly damaging 0.63
R7574:Ubr1 UTSW 2 120873191 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GAACGCTCCACTGTGTTTTAATTTC -3'
(R):5'- TTCCTGTTGCAAGTGGAAGAG -3'

Sequencing Primer
(F):5'- TTCTCTAAGCAAATATCCGGATCC -3'
(R):5'- GAAAAGTCTGATTGCCATCT -3'
Posted On2019-05-13