Incidental Mutation 'R6994:Spen'
ID544030
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Namespen family transcription repressor
SynonymsMint
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6994 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location141467890-141538597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141493459 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 396 (T396A)
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078886] [ENSMUST00000105786]
Predicted Effect unknown
Transcript: ENSMUST00000078886
AA Change: T396A
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: T396A

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000105786
AA Change: T396A
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: T396A

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T G 4: 144,623,279 W369G probably damaging Het
Abhd16b C T 2: 181,493,668 T121M possibly damaging Het
Adam5 A T 8: 24,786,246 C468* probably null Het
Aim2 C T 1: 173,455,586 A78V possibly damaging Het
Alg9 G A 9: 50,792,122 W254* probably null Het
Ankrd55 G C 13: 112,368,300 E499Q probably benign Het
Atp6v0a2 T C 5: 124,714,145 F546S probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Bpi A T 2: 158,258,244 probably benign Het
Bves A G 10: 45,339,418 H63R probably benign Het
Ccdc183 T C 2: 25,617,045 M45V probably benign Het
Cmklr1 T C 5: 113,614,922 Y6C probably damaging Het
Colgalt1 C T 8: 71,623,521 R539C probably damaging Het
Ctsm T A 13: 61,539,884 E53D probably damaging Het
Cyp2a22 A G 7: 26,939,181 probably null Het
Ddx10 A G 9: 53,204,111 V641A probably damaging Het
Ddx6 T C 9: 44,628,723 V316A probably damaging Het
Dhx34 T C 7: 16,203,874 D767G probably benign Het
Dtnbp1 T A 13: 45,001,929 D15V probably damaging Het
Dtx3l C T 16: 35,931,372 probably null Het
Entpd8 T C 2: 25,083,309 I162T probably damaging Het
Fam186a G T 15: 99,942,466 Q1966K probably benign Het
Fbxo27 A C 7: 28,693,360 D22A probably damaging Het
Fermt3 A T 19: 6,999,727 I577N probably damaging Het
Frmd8 A T 19: 5,873,181 S81T probably damaging Het
Gm4788 T A 1: 139,736,930 I464L possibly damaging Het
Gm5108 T A 5: 67,944,669 probably benign Het
Gm9195 T C 14: 72,480,831 Y135C probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
H2afy T C 13: 56,089,830 N206D probably benign Het
Kcnh8 A T 17: 52,977,695 I898F probably benign Het
Kri1 C T 9: 21,287,787 probably benign Het
Krt32 T A 11: 100,086,445 I210F probably damaging Het
Lama1 G A 17: 67,753,825 C716Y Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Lpin3 C T 2: 160,904,883 P766L probably damaging Het
Marf1 T C 16: 14,128,857 T1169A probably damaging Het
Morc1 G A 16: 48,565,621 V536M probably benign Het
Morc1 A T 16: 48,618,546 H768L probably benign Het
Mpped2 T A 2: 106,699,533 H42Q possibly damaging Het
Nfatc1 G T 18: 80,653,564 probably null Het
Nfkbid G A 7: 30,425,767 S263N probably benign Het
Npas3 C A 12: 54,068,793 Q802K probably damaging Het
Olfr202 T G 16: 59,284,090 M136L possibly damaging Het
Olfr492 T A 7: 108,322,894 I261F possibly damaging Het
Olfr591 T C 7: 103,172,912 T242A probably damaging Het
Pabpc4l C A 3: 46,446,910 V100L possibly damaging Het
Pagr1a A G 7: 127,016,441 probably null Het
Pcdh1 A T 18: 38,198,500 N483K probably damaging Het
Pih1d3 T C 1: 31,222,909 probably benign Het
Pikfyve C A 1: 65,252,530 P1303T probably damaging Het
Plekhh3 T A 11: 101,165,693 probably null Het
Pnkd T A 1: 74,293,176 probably null Het
Pparg A T 6: 115,451,050 Q166L probably benign Het
Psenen A G 7: 30,563,507 probably null Het
Rab4a T C 8: 123,830,366 S142P probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Relt A C 7: 100,853,114 probably benign Het
Rftn1 T A 17: 50,036,991 T90S possibly damaging Het
Ripor3 T G 2: 167,997,266 D105A probably damaging Het
Rnase10 T A 14: 51,009,681 I135N probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rttn A G 18: 89,028,899 E895G probably damaging Het
Serpina3a G A 12: 104,112,830 probably null Het
Slco5a1 C T 1: 12,881,393 C562Y probably damaging Het
Tgfbr3 A G 5: 107,133,026 S623P probably damaging Het
Tmem8b A G 4: 43,690,192 I876V probably damaging Het
Tmod3 T C 9: 75,509,387 K221R probably damaging Het
Tomm40 G T 7: 19,702,906 D40E probably damaging Het
Trav6d-4 G T 14: 52,753,591 G28V probably damaging Het
Trav8d-2 G T 14: 53,042,476 A17S probably benign Het
Triml2 T C 8: 43,190,078 C158R possibly damaging Het
Trip10 A G 17: 57,255,331 E283G probably damaging Het
Tubb2b T C 13: 34,127,535 Y425C probably damaging Het
Ubr1 T C 2: 120,963,593 T37A probably benign Het
Unc13b A G 4: 43,171,403 probably benign Het
Unc13b A G 4: 43,173,203 probably benign Het
Vcan A T 13: 89,693,407 D379E possibly damaging Het
Vmn1r44 T A 6: 89,894,158 H295Q probably benign Het
Vmn2r16 A T 5: 109,340,103 S281C probably damaging Het
Vmn2r84 C T 10: 130,391,007 A321T possibly damaging Het
Vsig10l A T 7: 43,465,067 H271L possibly damaging Het
Vwa8 A T 14: 78,908,156 H91L possibly damaging Het
Zfp957 T A 14: 79,213,690 E223V probably damaging Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141489901 missense unknown
IGL01357:Spen APN 4 141517113 missense unknown
IGL02184:Spen APN 4 141487606 missense unknown
IGL02226:Spen APN 4 141478146 missense unknown
IGL02321:Spen APN 4 141517130 missense unknown
IGL02350:Spen APN 4 141477579 missense unknown
IGL02357:Spen APN 4 141477579 missense unknown
IGL02627:Spen APN 4 141473015 missense probably damaging 0.99
IGL02683:Spen APN 4 141471645 missense probably benign 0.06
IGL02945:Spen APN 4 141494313 missense unknown
IGL02950:Spen APN 4 141469508 missense probably damaging 1.00
IGL03008:Spen APN 4 141476137 missense possibly damaging 0.70
IGL03019:Spen APN 4 141478916 missense unknown
IGL03038:Spen APN 4 141538239 missense unknown
IGL03334:Spen APN 4 141469969 missense probably damaging 1.00
R0105:Spen UTSW 4 141469810 splice site probably benign
R0268:Spen UTSW 4 141477557 missense unknown
R0359:Spen UTSW 4 141516870 missense unknown
R0394:Spen UTSW 4 141474203 missense probably benign 0.03
R0423:Spen UTSW 4 141479336 missense unknown
R0433:Spen UTSW 4 141483758 missense unknown
R0462:Spen UTSW 4 141473651 missense probably damaging 1.00
R0687:Spen UTSW 4 141488028 missense unknown
R0699:Spen UTSW 4 141474391 missense possibly damaging 0.72
R0865:Spen UTSW 4 141471870 missense probably benign 0.11
R0918:Spen UTSW 4 141485564 missense unknown
R1034:Spen UTSW 4 141475752 missense probably benign 0.33
R1341:Spen UTSW 4 141469400 missense possibly damaging 0.78
R1401:Spen UTSW 4 141471821 missense probably damaging 0.98
R1509:Spen UTSW 4 141475635 missense probably benign 0.00
R1509:Spen UTSW 4 141475700 missense possibly damaging 0.53
R1561:Spen UTSW 4 141472383 nonsense probably null
R1589:Spen UTSW 4 141488024 missense unknown
R1640:Spen UTSW 4 141468943 missense probably damaging 0.98
R1758:Spen UTSW 4 141476375 missense unknown
R1764:Spen UTSW 4 141472950 missense probably damaging 1.00
R1824:Spen UTSW 4 141472785 missense probably damaging 1.00
R1899:Spen UTSW 4 141470343 missense probably benign 0.17
R1916:Spen UTSW 4 141472598 missense probably damaging 1.00
R2011:Spen UTSW 4 141473329 missense probably damaging 1.00
R2295:Spen UTSW 4 141477273 missense unknown
R2379:Spen UTSW 4 141516927 missense unknown
R2404:Spen UTSW 4 141477905 missense unknown
R3719:Spen UTSW 4 141517183 missense unknown
R3889:Spen UTSW 4 141477881 missense unknown
R3945:Spen UTSW 4 141477353 missense unknown
R4227:Spen UTSW 4 141522147 missense unknown
R4326:Spen UTSW 4 141477372 missense unknown
R4382:Spen UTSW 4 141473139 missense possibly damaging 0.88
R4542:Spen UTSW 4 141476786 missense unknown
R4757:Spen UTSW 4 141473079 nonsense probably null
R4771:Spen UTSW 4 141472596 missense probably benign 0.14
R5072:Spen UTSW 4 141522302 missense unknown
R5121:Spen UTSW 4 141476099 missense probably benign 0.00
R5176:Spen UTSW 4 141476276 missense unknown
R5290:Spen UTSW 4 141473816 missense probably damaging 1.00
R5291:Spen UTSW 4 141488079 missense unknown
R5293:Spen UTSW 4 141472406 missense possibly damaging 0.89
R5347:Spen UTSW 4 141471485 missense probably benign 0.26
R5511:Spen UTSW 4 141475064 missense possibly damaging 0.86
R5511:Spen UTSW 4 141516838 missense unknown
R5772:Spen UTSW 4 141478184 missense unknown
R5834:Spen UTSW 4 141471843 missense possibly damaging 0.63
R5858:Spen UTSW 4 141473871 missense probably benign 0.05
R6214:Spen UTSW 4 141479112 missense unknown
R6232:Spen UTSW 4 141517022 missense unknown
R6345:Spen UTSW 4 141471633 missense possibly damaging 0.86
R6419:Spen UTSW 4 141476310 missense unknown
R6455:Spen UTSW 4 141475509 missense probably damaging 0.97
R6979:Spen UTSW 4 141478063 missense unknown
R7018:Spen UTSW 4 141493444 missense unknown
R7040:Spen UTSW 4 141494382 missense unknown
R7127:Spen UTSW 4 141476108 missense possibly damaging 0.53
R7218:Spen UTSW 4 141472650 missense possibly damaging 0.54
R7234:Spen UTSW 4 141479135 missense unknown
R7316:Spen UTSW 4 141477054 missense unknown
R7350:Spen UTSW 4 141479385 missense unknown
R7356:Spen UTSW 4 141471924 nonsense probably null
R7400:Spen UTSW 4 141473741 missense probably damaging 1.00
R7470:Spen UTSW 4 141479294 missense unknown
R7698:Spen UTSW 4 141472845 missense probably damaging 1.00
R7858:Spen UTSW 4 141488131 splice site probably null
R7941:Spen UTSW 4 141488131 splice site probably null
R8033:Spen UTSW 4 141471746 missense probably benign 0.03
R8064:Spen UTSW 4 141475700 missense possibly damaging 0.53
T0722:Spen UTSW 4 141474353 missense probably benign 0.33
T0975:Spen UTSW 4 141474353 missense probably benign 0.33
Z1088:Spen UTSW 4 141477976 missense unknown
Z1088:Spen UTSW 4 141477977 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGGTGCGGGTTTCTCCATG -3'
(R):5'- CAGGTAACATGAGAAGATGTGCTTG -3'

Sequencing Primer
(F):5'- GGTTTCTCCATGGCAAAAGC -3'
(R):5'- GTCTTGTTTGACTCTGTAGACACAAG -3'
Posted On2019-05-13