Mutagenetix > Incidental Mutation

Incidental Mutation 'R6994:Atp6v0a2'

544036

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R6994 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124714145 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 546 (F546S)

Ref Sequence

ENSEMBL: ENSMUSP00000039737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000197161] [ENSMUST00000198382]

AlphaFold

P15920

PDB Structure

NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037865
AA Change: F546S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: F546S

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000197161

SMART Domains

Protein: ENSMUSP00000143461
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000198382

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Meta Mutation Damage Score

0.9554

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

96% (82/85)

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	T	G	4: 144,623,279	W369G	probably damaging	Het
Abhd16b	C	T	2: 181,493,668	T121M	possibly damaging	Het
Adam5	A	T	8: 24,786,246	C468*	probably null	Het
Aim2	C	T	1: 173,455,586	A78V	possibly damaging	Het
Alg9	G	A	9: 50,792,122	W254*	probably null	Het
Ankrd55	G	C	13: 112,368,300	E499Q	probably benign	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Bpi	A	T	2: 158,258,244		probably benign	Het
Bves	A	G	10: 45,339,418	H63R	probably benign	Het
Ccdc183	T	C	2: 25,617,045	M45V	probably benign	Het
Cmklr1	T	C	5: 113,614,922	Y6C	probably damaging	Het
Colgalt1	C	T	8: 71,623,521	R539C	probably damaging	Het
Ctsm	T	A	13: 61,539,884	E53D	probably damaging	Het
Cyp2a22	A	G	7: 26,939,181		probably null	Het
Ddx10	A	G	9: 53,204,111	V641A	probably damaging	Het
Ddx6	T	C	9: 44,628,723	V316A	probably damaging	Het
Dhx34	T	C	7: 16,203,874	D767G	probably benign	Het
Dtnbp1	T	A	13: 45,001,929	D15V	probably damaging	Het
Dtx3l	C	T	16: 35,931,372		probably null	Het
Entpd8	T	C	2: 25,083,309	I162T	probably damaging	Het
Fam186a	G	T	15: 99,942,466	Q1966K	probably benign	Het
Fbxo27	A	C	7: 28,693,360	D22A	probably damaging	Het
Fermt3	A	T	19: 6,999,727	I577N	probably damaging	Het
Frmd8	A	T	19: 5,873,181	S81T	probably damaging	Het
Gm4788	T	A	1: 139,736,930	I464L	possibly damaging	Het
Gm5108	T	A	5: 67,944,669		probably benign	Het
Gm9195	T	C	14: 72,480,831	Y135C	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
H2afy	T	C	13: 56,089,830	N206D	probably benign	Het
Kcnh8	A	T	17: 52,977,695	I898F	probably benign	Het
Kri1	C	T	9: 21,287,787		probably benign	Het
Krt32	T	A	11: 100,086,445	I210F	probably damaging	Het
Lama1	G	A	17: 67,753,825	C716Y		Het
Lamc2	G	A	1: 153,136,762	T722M	probably benign	Het
Lpin3	C	T	2: 160,904,883	P766L	probably damaging	Het
Marf1	T	C	16: 14,128,857	T1169A	probably damaging	Het
Morc1	G	A	16: 48,565,621	V536M	probably benign	Het
Morc1	A	T	16: 48,618,546	H768L	probably benign	Het
Mpped2	T	A	2: 106,699,533	H42Q	possibly damaging	Het
Nfatc1	G	T	18: 80,653,564		probably null	Het
Nfkbid	G	A	7: 30,425,767	S263N	probably benign	Het
Npas3	C	A	12: 54,068,793	Q802K	probably damaging	Het
Olfr202	T	G	16: 59,284,090	M136L	possibly damaging	Het
Olfr492	T	A	7: 108,322,894	I261F	possibly damaging	Het
Olfr591	T	C	7: 103,172,912	T242A	probably damaging	Het
Pabpc4l	C	A	3: 46,446,910	V100L	possibly damaging	Het
Pagr1a	A	G	7: 127,016,441		probably null	Het
Pcdh1	A	T	18: 38,198,500	N483K	probably damaging	Het
Pih1d3	T	C	1: 31,222,909		probably benign	Het
Pikfyve	C	A	1: 65,252,530	P1303T	probably damaging	Het
Plekhh3	T	A	11: 101,165,693		probably null	Het
Pnkd	T	A	1: 74,293,176		probably null	Het
Pparg	A	T	6: 115,451,050	Q166L	probably benign	Het
Psenen	A	G	7: 30,563,507		probably null	Het
Rab4a	T	C	8: 123,830,366	S142P	probably damaging	Het
Reg3a	T	C	6: 78,381,149	V21A	probably benign	Het
Relt	A	C	7: 100,853,114		probably benign	Het
Rftn1	T	A	17: 50,036,991	T90S	possibly damaging	Het
Ripor3	T	G	2: 167,997,266	D105A	probably damaging	Het
Rnase10	T	A	14: 51,009,681	I135N	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Rttn	A	G	18: 89,028,899	E895G	probably damaging	Het
Serpina3a	G	A	12: 104,112,830		probably null	Het
Slco5a1	C	T	1: 12,881,393	C562Y	probably damaging	Het
Spen	T	C	4: 141,493,459	T396A	unknown	Het
Tgfbr3	A	G	5: 107,133,026	S623P	probably damaging	Het
Tmem8b	A	G	4: 43,690,192	I876V	probably damaging	Het
Tmod3	T	C	9: 75,509,387	K221R	probably damaging	Het
Tomm40	G	T	7: 19,702,906	D40E	probably damaging	Het
Trav6d-4	G	T	14: 52,753,591	G28V	probably damaging	Het
Trav8d-2	G	T	14: 53,042,476	A17S	probably benign	Het
Triml2	T	C	8: 43,190,078	C158R	possibly damaging	Het
Trip10	A	G	17: 57,255,331	E283G	probably damaging	Het
Tubb2b	T	C	13: 34,127,535	Y425C	probably damaging	Het
Ubr1	T	C	2: 120,963,593	T37A	probably benign	Het
Unc13b	A	G	4: 43,171,403		probably benign	Het
Unc13b	A	G	4: 43,173,203		probably benign	Het
Vcan	A	T	13: 89,693,407	D379E	possibly damaging	Het
Vmn1r44	T	A	6: 89,894,158	H295Q	probably benign	Het
Vmn2r16	A	T	5: 109,340,103	S281C	probably damaging	Het
Vmn2r84	C	T	10: 130,391,007	A321T	possibly damaging	Het
Vsig10l	A	T	7: 43,465,067	H271L	possibly damaging	Het
Vwa8	A	T	14: 78,908,156	H91L	possibly damaging	Het
Zfp957	T	A	14: 79,213,690	E223V	probably damaging	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0128:Atp6v0a2	UTSW	5	124713184	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R1540:Atp6v0a2	UTSW	5	124646698	missense	probably damaging	1.00
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2922:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3889:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R3893:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4013:Atp6v0a2	UTSW	5	124712796	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5620:Atp6v0a2	UTSW	5	124645969	nonsense	probably null
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7268:Atp6v0a2	UTSW	5	124719866	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7748:Atp6v0a2	UTSW	5	124716496	missense	probably benign	0.00
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7778:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7901:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8765:Atp6v0a2	UTSW	5	124716470	missense	probably damaging	1.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9023:Atp6v0a2	UTSW	5	124719074	missense	possibly damaging	0.93
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9360:Atp6v0a2	UTSW	5	124629194	missense	possibly damaging	0.77
R9601:Atp6v0a2	UTSW	5	124713193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTAGCAAGATCTAGCAAGCTCC -3'
(R):5'- ATAAATAATGAGCGGGCACACC -3'

Sequencing Primer
(F):5'- CTTGCTCTTGCCCCCAAGG -3'
(R):5'- CACCTGCAACATCAATTCTTGGAGAG -3'

Posted On

2019-05-13