Incidental Mutation 'R6994:Rttn'
ID544090
Institutional Source Beutler Lab
Gene Symbol Rttn
Ensembl Gene ENSMUSG00000023066
Gene Namerotatin
SynonymsC530033I08Rik, 4921538A15Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_175542.3; MGI:2179288

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6994 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location88971790-89131013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89028899 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 895 (E895G)
Ref Sequence ENSEMBL: ENSMUSP00000023828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023828]
Predicted Effect probably damaging
Transcript: ENSMUST00000023828
AA Change: E895G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023828
Gene: ENSMUSG00000023066
AA Change: E895G

DomainStartEndE-ValueType
Pfam:RTTN_N 16 112 1.2e-36 PFAM
low complexity region 188 199 N/A INTRINSIC
Blast:ARM 216 261 9e-18 BLAST
low complexity region 302 319 N/A INTRINSIC
low complexity region 335 341 N/A INTRINSIC
SCOP:d1gw5a_ 515 952 9e-3 SMART
Blast:ARM 863 910 4e-8 BLAST
low complexity region 972 985 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1213 1222 N/A INTRINSIC
low complexity region 1680 1698 N/A INTRINSIC
low complexity region 1861 1879 N/A INTRINSIC
Blast:ARM 2088 2129 1e-10 BLAST
Meta Mutation Damage Score 0.6002 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (82/85)
MGI Phenotype Strain: 2674124
Lethality: E9-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein whose specific function is unknown. Absence of the orthologous protein in mouse results in embryonic lethality with deficient axial rotation, abnormal differentiation of the neural tube, and randomized looping of the heart tube during development. In human, mutations in this gene are associated with polymicrogyria with seizures. In human fibroblasts this protein localizes at the ciliary basal bodies. Given the intracellular localization of this protein and the phenotypic effects of mutations, this gene is suspected of playing a role in the maintenance of normal ciliary structure which in turn effects the developmental process of left-right organ specification, axial rotation, and perhaps notochord development. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for an insertional mutation exhibit embryonic lethality and neurulation defects resulting in the arrest of gastrulation movements and abnormal left-right specification in the heart. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(12) Transgenic(1)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T G 4: 144,623,279 W369G probably damaging Het
Abhd16b C T 2: 181,493,668 T121M possibly damaging Het
Adam5 A T 8: 24,786,246 C468* probably null Het
Aim2 C T 1: 173,455,586 A78V possibly damaging Het
Alg9 G A 9: 50,792,122 W254* probably null Het
Ankrd55 G C 13: 112,368,300 E499Q probably benign Het
Atp6v0a2 T C 5: 124,714,145 F546S probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Bpi A T 2: 158,258,244 probably benign Het
Bves A G 10: 45,339,418 H63R probably benign Het
Ccdc183 T C 2: 25,617,045 M45V probably benign Het
Cmklr1 T C 5: 113,614,922 Y6C probably damaging Het
Colgalt1 C T 8: 71,623,521 R539C probably damaging Het
Ctsm T A 13: 61,539,884 E53D probably damaging Het
Cyp2a22 A G 7: 26,939,181 probably null Het
Ddx10 A G 9: 53,204,111 V641A probably damaging Het
Ddx6 T C 9: 44,628,723 V316A probably damaging Het
Dhx34 T C 7: 16,203,874 D767G probably benign Het
Dtnbp1 T A 13: 45,001,929 D15V probably damaging Het
Dtx3l C T 16: 35,931,372 probably null Het
Entpd8 T C 2: 25,083,309 I162T probably damaging Het
Fam186a G T 15: 99,942,466 Q1966K probably benign Het
Fbxo27 A C 7: 28,693,360 D22A probably damaging Het
Fermt3 A T 19: 6,999,727 I577N probably damaging Het
Frmd8 A T 19: 5,873,181 S81T probably damaging Het
Gm4788 T A 1: 139,736,930 I464L possibly damaging Het
Gm5108 T A 5: 67,944,669 probably benign Het
Gm9195 T C 14: 72,480,831 Y135C probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
H2afy T C 13: 56,089,830 N206D probably benign Het
Kcnh8 A T 17: 52,977,695 I898F probably benign Het
Kri1 C T 9: 21,287,787 probably benign Het
Krt32 T A 11: 100,086,445 I210F probably damaging Het
Lama1 G A 17: 67,753,825 C716Y Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Lpin3 C T 2: 160,904,883 P766L probably damaging Het
Marf1 T C 16: 14,128,857 T1169A probably damaging Het
Morc1 G A 16: 48,565,621 V536M probably benign Het
Morc1 A T 16: 48,618,546 H768L probably benign Het
Mpped2 T A 2: 106,699,533 H42Q possibly damaging Het
Nfatc1 G T 18: 80,653,564 probably null Het
Nfkbid G A 7: 30,425,767 S263N probably benign Het
Npas3 C A 12: 54,068,793 Q802K probably damaging Het
Olfr202 T G 16: 59,284,090 M136L possibly damaging Het
Olfr492 T A 7: 108,322,894 I261F possibly damaging Het
Olfr591 T C 7: 103,172,912 T242A probably damaging Het
Pabpc4l C A 3: 46,446,910 V100L possibly damaging Het
Pagr1a A G 7: 127,016,441 probably null Het
Pcdh1 A T 18: 38,198,500 N483K probably damaging Het
Pih1d3 T C 1: 31,222,909 probably benign Het
Pikfyve C A 1: 65,252,530 P1303T probably damaging Het
Plekhh3 T A 11: 101,165,693 probably null Het
Pnkd T A 1: 74,293,176 probably null Het
Pparg A T 6: 115,451,050 Q166L probably benign Het
Psenen A G 7: 30,563,507 probably null Het
Rab4a T C 8: 123,830,366 S142P probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Relt A C 7: 100,853,114 probably benign Het
Rftn1 T A 17: 50,036,991 T90S possibly damaging Het
Ripor3 T G 2: 167,997,266 D105A probably damaging Het
Rnase10 T A 14: 51,009,681 I135N probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Serpina3a G A 12: 104,112,830 probably null Het
Slco5a1 C T 1: 12,881,393 C562Y probably damaging Het
Spen T C 4: 141,493,459 T396A unknown Het
Tgfbr3 A G 5: 107,133,026 S623P probably damaging Het
Tmem8b A G 4: 43,690,192 I876V probably damaging Het
Tmod3 T C 9: 75,509,387 K221R probably damaging Het
Tomm40 G T 7: 19,702,906 D40E probably damaging Het
Trav6d-4 G T 14: 52,753,591 G28V probably damaging Het
Trav8d-2 G T 14: 53,042,476 A17S probably benign Het
Triml2 T C 8: 43,190,078 C158R possibly damaging Het
Trip10 A G 17: 57,255,331 E283G probably damaging Het
Tubb2b T C 13: 34,127,535 Y425C probably damaging Het
Ubr1 T C 2: 120,963,593 T37A probably benign Het
Unc13b A G 4: 43,171,403 probably benign Het
Unc13b A G 4: 43,173,203 probably benign Het
Vcan A T 13: 89,693,407 D379E possibly damaging Het
Vmn1r44 T A 6: 89,894,158 H295Q probably benign Het
Vmn2r16 A T 5: 109,340,103 S281C probably damaging Het
Vmn2r84 C T 10: 130,391,007 A321T possibly damaging Het
Vsig10l A T 7: 43,465,067 H271L possibly damaging Het
Vwa8 A T 14: 78,908,156 H91L possibly damaging Het
Zfp957 T A 14: 79,213,690 E223V probably damaging Het
Other mutations in Rttn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rttn APN 18 88974340 missense probably benign 0.00
IGL00788:Rttn APN 18 88972509 missense probably benign 0.00
IGL00929:Rttn APN 18 89028935 missense probably damaging 1.00
IGL01392:Rttn APN 18 88995613 missense probably benign 0.03
IGL01395:Rttn APN 18 89129770 missense possibly damaging 0.89
IGL01701:Rttn APN 18 89064215 missense probably damaging 1.00
IGL02136:Rttn APN 18 89046128 missense possibly damaging 0.87
IGL02151:Rttn APN 18 89020205 missense probably damaging 1.00
IGL02165:Rttn APN 18 89043041 missense probably benign
IGL02228:Rttn APN 18 89042231 missense probably damaging 1.00
IGL02276:Rttn APN 18 89048454 missense possibly damaging 0.94
IGL02612:Rttn APN 18 88973626 missense probably damaging 1.00
IGL02645:Rttn APN 18 89110686 missense probably benign 0.04
IGL02716:Rttn APN 18 89048417 missense possibly damaging 0.77
IGL02820:Rttn APN 18 89028998 missense probably damaging 1.00
IGL02961:Rttn APN 18 89053573 missense probably damaging 1.00
IGL02973:Rttn APN 18 88972494 missense probably damaging 1.00
IGL03027:Rttn APN 18 88979690 missense probably damaging 1.00
IGL03082:Rttn APN 18 88983948 missense probably damaging 1.00
IGL03121:Rttn APN 18 88975751 missense probably damaging 1.00
IGL03135:Rttn APN 18 89015150 missense probably damaging 1.00
IGL03328:Rttn APN 18 89043028 missense probably benign 0.19
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0062:Rttn UTSW 18 89010966 critical splice donor site probably null
R0310:Rttn UTSW 18 89009460 splice site probably benign
R0330:Rttn UTSW 18 88986080 splice site probably null
R0363:Rttn UTSW 18 89010955 missense probably damaging 1.00
R0485:Rttn UTSW 18 89090419 splice site probably benign
R0590:Rttn UTSW 18 88979635 missense probably damaging 1.00
R0601:Rttn UTSW 18 89042966 missense probably benign 0.00
R0604:Rttn UTSW 18 88977758 missense probably damaging 1.00
R0631:Rttn UTSW 18 88989546 missense probably benign 0.00
R0882:Rttn UTSW 18 88973689 nonsense probably null
R0885:Rttn UTSW 18 88983810 missense probably benign 0.03
R0900:Rttn UTSW 18 89101691 missense probably benign 0.13
R1077:Rttn UTSW 18 89064249 missense probably damaging 1.00
R1444:Rttn UTSW 18 89042867 missense probably benign 0.04
R1460:Rttn UTSW 18 89109357 splice site probably benign
R1517:Rttn UTSW 18 89113350 missense probably benign 0.01
R1630:Rttn UTSW 18 89042954 missense probably benign 0.02
R1632:Rttn UTSW 18 89009336 missense probably benign 0.18
R1722:Rttn UTSW 18 88973531 missense probably benign 0.34
R1755:Rttn UTSW 18 89009317 missense probably damaging 1.00
R1881:Rttn UTSW 18 89015212 missense probably damaging 0.96
R1971:Rttn UTSW 18 89090433 missense probably benign
R2035:Rttn UTSW 18 89020216 missense probably damaging 1.00
R2109:Rttn UTSW 18 88986073 missense possibly damaging 0.93
R2191:Rttn UTSW 18 89095648 critical splice donor site probably null
R2201:Rttn UTSW 18 89010943 missense possibly damaging 0.88
R2266:Rttn UTSW 18 89064171 missense probably benign 0.05
R3014:Rttn UTSW 18 89014620 missense probably damaging 1.00
R3052:Rttn UTSW 18 89015246 splice site probably benign
R3427:Rttn UTSW 18 89095651 splice site probably null
R3431:Rttn UTSW 18 89095571 missense probably benign 0.04
R3786:Rttn UTSW 18 89037894 missense probably benign 0.00
R3803:Rttn UTSW 18 88977707 missense probably damaging 0.96
R3980:Rttn UTSW 18 89017275 missense probably benign 0.12
R4035:Rttn UTSW 18 88995653 missense probably benign 0.03
R4170:Rttn UTSW 18 88975723 missense probably damaging 1.00
R4223:Rttn UTSW 18 89095584 missense probably damaging 1.00
R4273:Rttn UTSW 18 89091896 missense probably benign
R4517:Rttn UTSW 18 89028973 missense probably damaging 0.99
R4674:Rttn UTSW 18 89011011 intron probably null
R4837:Rttn UTSW 18 89090415 splice site probably null
R4869:Rttn UTSW 18 89043014 nonsense probably null
R4881:Rttn UTSW 18 89101685 missense probably damaging 1.00
R4959:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4973:Rttn UTSW 18 89042168 missense probably damaging 1.00
R4975:Rttn UTSW 18 89064085 intron probably null
R5166:Rttn UTSW 18 89013094 missense possibly damaging 0.48
R5243:Rttn UTSW 18 89108063 missense possibly damaging 0.74
R5594:Rttn UTSW 18 89090436 missense possibly damaging 0.95
R5654:Rttn UTSW 18 89048432 missense probably benign
R5794:Rttn UTSW 18 88995569 missense probably benign 0.18
R5799:Rttn UTSW 18 89037946 missense probably damaging 0.99
R5955:Rttn UTSW 18 89121009 missense probably damaging 0.99
R5963:Rttn UTSW 18 89073695 missense probably benign 0.01
R5989:Rttn UTSW 18 88973626 missense probably damaging 1.00
R6004:Rttn UTSW 18 89021692 missense probably damaging 0.96
R6132:Rttn UTSW 18 89115646 critical splice donor site probably null
R6430:Rttn UTSW 18 89021685 missense probably null 0.18
R6436:Rttn UTSW 18 89110729 missense probably damaging 1.00
R6681:Rttn UTSW 18 89014611 missense probably damaging 1.00
R7049:Rttn UTSW 18 89064216 missense probably damaging 1.00
R7078:Rttn UTSW 18 89009422 missense probably benign 0.03
R7083:Rttn UTSW 18 89090598 missense probably damaging 1.00
R7250:Rttn UTSW 18 88989523 missense probably benign 0.03
R7402:Rttn UTSW 18 88985911 missense possibly damaging 0.92
R7565:Rttn UTSW 18 89060479 missense probably damaging 1.00
R7588:Rttn UTSW 18 89064229 missense probably damaging 0.97
X0017:Rttn UTSW 18 89113402 missense probably benign 0.01
X0022:Rttn UTSW 18 88973667 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGTACAGGGGAATGCCAG -3'
(R):5'- GGAAGTCACTTTTAACTCTGGTTAG -3'

Sequencing Primer
(F):5'- TTGGGATAGCATTGGAATGTAAATG -3'
(R):5'- CTCTGGTTAGAGGATGAACACATAAG -3'
Posted On2019-05-13