Incidental Mutation 'R6995:Ptprc'
ID544096
Institutional Source Beutler Lab
Gene Symbol Ptprc
Ensembl Gene ENSMUSG00000026395
Gene Nameprotein tyrosine phosphatase, receptor type, C
SynonymsB220, Ly-5, Lyt-4, CD45, T200
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R6995 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location138062861-138175708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138088744 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 513 (V513A)
Ref Sequence ENSEMBL: ENSMUSP00000138800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301]
Predicted Effect probably damaging
Transcript: ENSMUST00000182283
AA Change: V513A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: V513A

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182755
AA Change: V489A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: V489A

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: V652A

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A G 7: 40,994,725 Y606C probably benign Het
5430419D17Rik G T 7: 131,222,671 W165L probably damaging Het
5830411N06Rik G A 7: 140,261,601 D273N probably benign Het
Acad9 A G 3: 36,085,481 Y410C probably damaging Het
Acot6 C T 12: 84,109,375 P366S probably damaging Het
Anks1 G T 17: 28,054,299 G964V probably damaging Het
Apol7a A T 15: 77,389,976 probably benign Het
Arid3c G A 4: 41,725,087 A320V probably damaging Het
Bnip3l A T 14: 66,999,652 N50K probably benign Het
C130060K24Rik A T 6: 65,441,301 K151I probably damaging Het
C1qtnf4 C A 2: 90,889,953 A190D probably benign Het
Cdh1 G T 8: 106,660,913 V482L probably benign Het
Cdrt4 A C 11: 62,992,660 I63L probably benign Het
Cic A T 7: 25,271,311 T156S possibly damaging Het
Ckm A G 7: 19,420,231 N301S probably benign Het
Colgalt1 C T 8: 71,623,521 R539C probably damaging Het
Cop1 A G 1: 159,306,584 D132G probably damaging Het
Cpd G T 11: 76,785,055 N1257K probably benign Het
Cyp2c67 T C 19: 39,615,679 H411R probably damaging Het
Cyp2r1 A T 7: 114,553,081 F5I probably damaging Het
Dclk3 T A 9: 111,467,700 L104Q possibly damaging Het
Dnah7c A T 1: 46,455,813 Q67L probably benign Het
Dnm1l C A 16: 16,329,807 E365* probably null Het
Dst A T 1: 34,166,234 I502F probably damaging Het
Espl1 T C 15: 102,304,100 V547A possibly damaging Het
Fam26e A T 10: 34,096,193 M82K probably benign Het
Foxa1 C T 12: 57,542,478 A319T probably benign Het
Frem1 G T 4: 82,986,601 H859N probably damaging Het
Frem3 T A 8: 80,612,579 D500E probably damaging Het
Gm9774 T C 3: 92,429,008 probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grip1 A G 10: 119,986,470 D394G probably damaging Het
Gsap C A 5: 21,271,237 T589K possibly damaging Het
Gsg1l A G 7: 125,923,486 V190A probably damaging Het
Kcnmb1 A T 11: 33,970,131 T115S probably benign Het
Kirrel2 A C 7: 30,455,179 F169C probably damaging Het
L3mbtl1 C T 2: 162,961,448 T397M probably damaging Het
Lama1 G A 17: 67,753,825 C716Y Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Lrig1 T C 6: 94,611,629 D513G possibly damaging Het
Lrrk1 T C 7: 66,292,342 D716G probably damaging Het
Matn4 G A 2: 164,389,664 R582* probably null Het
Mdn1 A T 4: 32,733,374 R3133W probably benign Het
Mmp7 A G 9: 7,695,488 D122G probably damaging Het
Naaladl1 A G 19: 6,115,548 D744G possibly damaging Het
Nampt T G 12: 32,848,743 Y453D probably benign Het
Nlrp12 A G 7: 3,239,851 V677A probably benign Het
Ntng2 T C 2: 29,197,068 N414S probably damaging Het
Olfr1 A G 11: 73,395,584 V146A probably benign Het
Olfr1160 A C 2: 88,006,185 F189V probably benign Het
Olfr1284 A G 2: 111,379,363 D121G probably damaging Het
Olfr472 A G 7: 107,903,622 R302G probably benign Het
Parp4 A C 14: 56,613,739 Q733P probably damaging Het
Pdcl3 G A 1: 38,995,336 V56I probably benign Het
Pepd A G 7: 35,021,719 Y256C probably damaging Het
Plg G T 17: 12,419,051 R788L probably benign Het
Plod1 A T 4: 147,916,218 probably benign Het
Pxdn T C 12: 29,995,371 I373T possibly damaging Het
Rbbp8 G A 18: 11,718,908 G262E probably damaging Het
Rfc2 T A 5: 134,594,250 Y240* probably null Het
Rps15 A G 10: 80,293,764 E71G possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr1 A C 7: 29,094,182 M1287R probably damaging Het
Serpina9 A G 12: 104,001,236 L300P probably damaging Het
Sh3rf2 G A 18: 42,101,541 A130T probably damaging Het
Slc12a8 G A 16: 33,534,893 W26* probably null Het
Snx18 A T 13: 113,594,729 H576Q probably damaging Het
Tagln3 G A 16: 45,722,958 T107I probably benign Het
Thap1 C A 8: 26,162,651 T139K probably damaging Het
Tle4 T A 19: 14,564,453 probably null Het
Tmem87a A T 2: 120,362,928 M502K possibly damaging Het
Tpcn2 A T 7: 145,256,785 V605E probably benign Het
Trgj1 C A 13: 19,210,359 probably benign Het
Tsc2 A T 17: 24,628,054 V179E probably damaging Het
Ubap2l T C 3: 90,009,241 T909A probably damaging Het
Ubl4b T G 3: 107,554,824 Q40P probably damaging Het
Vmn1r229 A G 17: 20,815,015 D174G probably damaging Het
Vmn2r50 A T 7: 10,046,037 Y472* probably null Het
Vmn2r74 T A 7: 85,952,735 D565V probably benign Het
Vmn2r74 T A 7: 85,957,652 probably null Het
Vmn2r82 T A 10: 79,396,543 V792E probably damaging Het
Zfp335 G A 2: 164,893,290 Q1179* probably null Het
Zmynd12 A C 4: 119,453,575 K327Q probably benign Het
Zwilch G A 9: 64,165,449 Q27* probably null Het
Other mutations in Ptprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138083790 splice site probably benign
IGL00486:Ptprc APN 1 138115621 missense probably damaging 0.97
IGL00771:Ptprc APN 1 138113677 missense probably benign 0.00
IGL00833:Ptprc APN 1 138078492 missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138113642 missense probably damaging 1.00
IGL01020:Ptprc APN 1 138120173 critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138080912 missense probably damaging 1.00
IGL01302:Ptprc APN 1 138099631 missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138099481 critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 138068410 missense possibly damaging 0.88
IGL01775:Ptprc APN 1 138064759 missense probably damaging 1.00
IGL01820:Ptprc APN 1 138066198 missense probably damaging 1.00
IGL02340:Ptprc APN 1 138071219 missense probably damaging 1.00
IGL02943:Ptprc APN 1 138099513 missense probably damaging 0.99
IGL03169:Ptprc APN 1 138113619 missense probably benign 0.15
IGL03308:Ptprc APN 1 138126320 missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138093001 missense probably damaging 1.00
belittle UTSW 1 138137493 intron probably benign
bletchley UTSW 1 138117862 missense probably benign
Blush UTSW 1 138117720 intron probably benign
bruise UTSW 1 138064771 missense probably damaging 1.00
chor_muang UTSW 1 138113562 critical splice donor site probably null
crystal UTSW 1 138072255 critical splice donor site probably null
Dumpling UTSW 1 138067890 missense probably damaging 1.00
fuchsia UTSW 1 138101041 critical splice donor site probably null
Gentian UTSW 1 138067885 critical splice donor site probably null
guotie UTSW 1 138068401 nonsense probably null
guotie2 UTSW 1 138094299 missense probably damaging 0.97
Guotie3 UTSW 1 138078451 missense possibly damaging 0.92
Gyoza UTSW 1 138083567 missense probably damaging 1.00
Half_measure UTSW 1 138071249 missense probably damaging 0.98
jirisan UTSW 1 138113678 nonsense probably null
mauve UTSW 1 138099685 missense probably benign
Perverse UTSW 1 138101044 missense probably benign 0.02
ultra UTSW 1 138078445 critical splice donor site probably null
violaceous UTSW 1 138083639 missense possibly damaging 0.77
R0013:Ptprc UTSW 1 138113559 unclassified probably null
R0189:Ptprc UTSW 1 138082715 missense probably benign 0.10
R0390:Ptprc UTSW 1 138122575 missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138088697 missense probably damaging 1.00
R0602:Ptprc UTSW 1 138089485 splice site probably benign
R0627:Ptprc UTSW 1 138068320 missense probably damaging 0.99
R0632:Ptprc UTSW 1 138073610 missense probably benign 0.01
R0751:Ptprc UTSW 1 138092930 missense probably damaging 1.00
R0839:Ptprc UTSW 1 138101132 missense possibly damaging 0.47
R0942:Ptprc UTSW 1 138068401 nonsense probably null
R0943:Ptprc UTSW 1 138111164 missense probably damaging 0.96
R1159:Ptprc UTSW 1 138072319 missense probably damaging 1.00
R1442:Ptprc UTSW 1 138072312 missense probably damaging 1.00
R1489:Ptprc UTSW 1 138120086 missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1728:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1728:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1728:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1728:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1729:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1729:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1729:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1729:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1730:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1730:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1730:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1730:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1739:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1739:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1739:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1739:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1762:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1762:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1762:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1762:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1783:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1783:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1783:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1783:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1783:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1784:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1784:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1784:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1784:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138099676 missense probably benign 0.05
R1785:Ptprc UTSW 1 138107823 missense probably benign 0.22
R1785:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1785:Ptprc UTSW 1 138107837 missense probably benign 0.09
R1785:Ptprc UTSW 1 138112254 missense possibly damaging 0.53
R1862:Ptprc UTSW 1 138112227 missense probably benign 0.13
R2145:Ptprc UTSW 1 138073681 missense probably damaging 1.00
R2290:Ptprc UTSW 1 138111188 missense probably benign 0.00
R2403:Ptprc UTSW 1 138088532 missense probably damaging 1.00
R2439:Ptprc UTSW 1 138066152 missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138080178 missense probably damaging 1.00
R2906:Ptprc UTSW 1 138064534 missense possibly damaging 0.93
R3774:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3775:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3776:Ptprc UTSW 1 138064773 missense probably damaging 0.97
R3834:Ptprc UTSW 1 138083567 missense probably damaging 1.00
R4019:Ptprc UTSW 1 138078516 missense probably damaging 1.00
R4377:Ptprc UTSW 1 138067925 missense probably benign 0.04
R4580:Ptprc UTSW 1 138071251 missense probably benign 0.09
R4923:Ptprc UTSW 1 138078498 missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138099497 missense probably benign 0.04
R4937:Ptprc UTSW 1 138089500 missense probably damaging 1.00
R4970:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5112:Ptprc UTSW 1 138094299 missense probably damaging 0.97
R5145:Ptprc UTSW 1 138089566 missense probably benign 0.07
R5158:Ptprc UTSW 1 138175084 missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138117862 missense probably benign
R5593:Ptprc UTSW 1 138117720 intron probably benign
R5689:Ptprc UTSW 1 138117777 missense probably benign 0.01
R5885:Ptprc UTSW 1 138088508 missense probably damaging 1.00
R6010:Ptprc UTSW 1 138101056 missense probably benign 0.09
R6026:Ptprc UTSW 1 138071249 missense probably damaging 0.98
R6047:Ptprc UTSW 1 138101041 critical splice donor site probably null
R6173:Ptprc UTSW 1 138067890 missense probably damaging 1.00
R6328:Ptprc UTSW 1 138113678 nonsense probably null
R6383:Ptprc UTSW 1 138078451 missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138083639 missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138113562 critical splice donor site probably null
R6520:Ptprc UTSW 1 138080143 nonsense probably null
R6805:Ptprc UTSW 1 138067885 critical splice donor site probably null
R6830:Ptprc UTSW 1 138072255 critical splice donor site probably null
R6847:Ptprc UTSW 1 138088545 missense probably damaging 0.99
R6960:Ptprc UTSW 1 138078445 critical splice donor site probably null
R7009:Ptprc UTSW 1 138064553 missense probably damaging 0.97
R7041:Ptprc UTSW 1 138126309 missense probably benign 0.04
R7055:Ptprc UTSW 1 138089571 missense probably damaging 1.00
R7098:Ptprc UTSW 1 138099685 missense probably benign
R7164:Ptprc UTSW 1 138117862 missense probably benign
R7188:Ptprc UTSW 1 138071180 missense probably damaging 1.00
R7191:Ptprc UTSW 1 138101044 missense probably benign 0.02
R7204:Ptprc UTSW 1 138117862 missense probably benign
R7316:Ptprc UTSW 1 138064771 missense probably damaging 1.00
R7644:Ptprc UTSW 1 138067907 missense probably benign 0.01
R7948:Ptprc UTSW 1 138064576 missense probably benign 0.45
R8029:Ptprc UTSW 1 138078459 missense probably damaging 1.00
Z1177:Ptprc UTSW 1 138067907 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTCCACACGGTTATAATCATCTG -3'
(R):5'- CCCATTTACCCAAAGTGATAACTG -3'

Sequencing Primer
(F):5'- CCACTCACAGGGAAGAAT -3'
(R):5'- ATGGATAAAACTCTGTTTTCTCTCC -3'
Posted On2019-05-13