Incidental Mutation 'R0608:Stxbp2'
ID 54411
Institutional Source Beutler Lab
Gene Symbol Stxbp2
Ensembl Gene ENSMUSG00000004626
Gene Name syntaxin binding protein 2
Synonyms muSec1, C79054, Sxtp2, Munc18b, Munc-18b, Munc-18-2
MMRRC Submission 038797-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0608 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 3680955-3693644 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3682559 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 49 (D49E)
Ref Sequence ENSEMBL: ENSMUSP00000125405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159888] [ENSMUST00000159911] [ENSMUST00000160708] [ENSMUST00000162867]
AlphaFold Q64324
Predicted Effect unknown
Transcript: ENSMUST00000004745
AA Change: D48E
SMART Domains Protein: ENSMUSP00000004745
Gene: ENSMUSG00000004626
AA Change: D48E

DomainStartEndE-ValueType
Pfam:Sec1 29 580 6.8e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159888
Predicted Effect probably damaging
Transcript: ENSMUST00000159911
AA Change: D49E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160435
Predicted Effect probably damaging
Transcript: ENSMUST00000160708
AA Change: D49E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125405
Gene: ENSMUSG00000004626
AA Change: D49E

DomainStartEndE-ValueType
Pfam:Sec1 29 579 4.9e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162974
Predicted Effect probably benign
Transcript: ENSMUST00000162867
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the STXBP/unc-18/SEC1 family. The encoded protein is involved in intracellular trafficking, control of SNARE (soluble NSF attachment protein receptor) complex assembly, and the release of cytotoxic granules by natural killer cells. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality. Mice heterozygous for this allele exhibit decreased stimulated mucin secretion, release of histones in stimulated mast cells and decreased susceptibility to type I hypersensitivity reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A G 14: 78,748,193 (GRCm39) V1398A probably benign Het
Ampd3 C A 7: 110,394,997 (GRCm39) D315E probably damaging Het
Ampd3 T A 7: 110,394,998 (GRCm39) F316I probably damaging Het
Arhgef40 A C 14: 52,234,431 (GRCm39) E911D probably damaging Het
Atxn2l A G 7: 126,100,588 (GRCm39) probably null Het
Bckdhb T G 9: 83,835,789 (GRCm39) F98V probably damaging Het
Calhm1 C T 19: 47,132,280 (GRCm39) V112I probably benign Het
Ccdc28a G A 10: 18,100,699 (GRCm39) R90C probably damaging Het
Cdc40 A T 10: 40,724,048 (GRCm39) Y247N probably benign Het
Cds1 G A 5: 101,962,299 (GRCm39) V305M probably damaging Het
Cep128 T G 12: 90,966,309 (GRCm39) probably benign Het
Cep72 A T 13: 74,186,423 (GRCm39) H249Q probably damaging Het
Cfap70 A T 14: 20,498,631 (GRCm39) Y19N probably damaging Het
Col11a1 T C 3: 114,012,364 (GRCm39) probably benign Het
Cstdc6 T C 16: 36,143,386 (GRCm39) probably null Het
Cysltr1 A G X: 105,622,261 (GRCm39) V75A possibly damaging Het
Dnaaf11 T A 15: 66,252,323 (GRCm39) M448L probably benign Het
Dnah17 G T 11: 117,981,575 (GRCm39) Y1716* probably null Het
Dnm1 T C 2: 32,225,836 (GRCm39) E383G possibly damaging Het
Dst C A 1: 34,329,437 (GRCm39) probably null Het
Edil3 T C 13: 89,332,968 (GRCm39) S375P probably damaging Het
Eme1 A G 11: 94,540,908 (GRCm39) C277R probably damaging Het
Enam T C 5: 88,640,886 (GRCm39) W183R possibly damaging Het
Fbxl6 C T 15: 76,420,953 (GRCm39) V341M probably benign Het
Fgf14 A G 14: 124,914,015 (GRCm39) S39P probably damaging Het
Fmo4 C T 1: 162,631,220 (GRCm39) R249H possibly damaging Het
Gle1 T A 2: 29,830,240 (GRCm39) D265E probably benign Het
Gml2 T C 15: 74,693,235 (GRCm39) probably null Het
Golgb1 G T 16: 36,736,692 (GRCm39) E1980* probably null Het
Hap1 A G 11: 100,240,131 (GRCm39) L555P probably damaging Het
Heca T C 10: 17,791,039 (GRCm39) D339G possibly damaging Het
Hepacam2 T C 6: 3,483,479 (GRCm39) T101A possibly damaging Het
Ift88 T C 14: 57,733,678 (GRCm39) V707A probably benign Het
Kdm3a C T 6: 71,597,030 (GRCm39) G252D probably benign Het
Klhl11 A G 11: 100,363,068 (GRCm39) Y163H probably damaging Het
Kntc1 A T 5: 123,924,137 (GRCm39) N1008Y probably damaging Het
Lrp2 G T 2: 69,316,587 (GRCm39) N2131K probably benign Het
Magi3 C G 3: 103,924,873 (GRCm39) G1092A probably damaging Het
Mef2a G T 7: 66,884,896 (GRCm39) S406* probably null Het
Minar2 A G 18: 59,195,531 (GRCm39) probably null Het
Mrps26 G T 2: 130,405,778 (GRCm39) R27L possibly damaging Het
Myof T C 19: 37,904,952 (GRCm39) D1624G probably damaging Het
Naif1 T C 2: 32,344,908 (GRCm39) M204T probably benign Het
Ndufb8 T C 19: 44,538,784 (GRCm39) E179G possibly damaging Het
Neb A T 2: 52,216,769 (GRCm39) D135E probably benign Het
Nlrp6 C T 7: 140,503,399 (GRCm39) Q502* probably null Het
Nploc4 A G 11: 120,304,507 (GRCm39) L238P probably damaging Het
Obi1 T C 14: 104,716,963 (GRCm39) Y470C probably damaging Het
Or4d2 G A 11: 87,784,022 (GRCm39) H243Y probably damaging Het
Parp4 T A 14: 56,839,861 (GRCm39) V523E probably damaging Het
Pdgfra T C 5: 75,324,438 (GRCm39) Y98H probably damaging Het
Plcz1 C T 6: 139,936,459 (GRCm39) R590H probably damaging Het
Pnliprp1 T A 19: 58,726,628 (GRCm39) Y328* probably null Het
Pnpla8 C T 12: 44,330,246 (GRCm39) P48L probably benign Het
Rab44 T A 17: 29,366,317 (GRCm39) probably null Het
Ranbp2 T C 10: 58,329,720 (GRCm39) I3031T probably damaging Het
Sbno1 T C 5: 124,522,604 (GRCm39) D1072G probably damaging Het
Senp7 A G 16: 55,944,236 (GRCm39) T187A possibly damaging Het
Serpinh1 A G 7: 98,998,601 (GRCm39) C10R unknown Het
Sh2d4a A G 8: 68,799,346 (GRCm39) Y405C possibly damaging Het
Slc26a7 T C 4: 14,621,317 (GRCm39) D23G probably benign Het
Slc7a7 A G 14: 54,615,259 (GRCm39) L246P probably damaging Het
Spire1 T C 18: 67,661,945 (GRCm39) R163G probably damaging Het
Susd2 C T 10: 75,474,069 (GRCm39) A509T probably benign Het
Sycp2 A G 2: 178,024,197 (GRCm39) F396L probably damaging Het
Syne2 T C 12: 76,010,587 (GRCm39) L2499P probably damaging Het
Syt10 C A 15: 89,711,144 (GRCm39) A130S probably benign Het
Sytl4 A T X: 132,862,936 (GRCm39) D16E probably benign Het
Tab2 C T 10: 7,795,883 (GRCm39) V126I probably damaging Het
Tecpr1 T C 5: 144,148,317 (GRCm39) T363A probably damaging Het
Terb2 A G 2: 122,016,816 (GRCm39) D16G probably benign Het
Tm2d2 A G 8: 25,510,552 (GRCm39) E137G probably benign Het
Trim30d T A 7: 104,121,692 (GRCm39) H201L probably damaging Het
Tspan3 A G 9: 56,054,669 (GRCm39) probably null Het
Ttn A T 2: 76,617,667 (GRCm39) L16268Q probably damaging Het
Ttn A T 2: 76,626,529 (GRCm39) probably null Het
Ubap2 T A 4: 41,218,319 (GRCm39) T263S probably benign Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Zeb2 A T 2: 44,886,138 (GRCm39) M973K possibly damaging Het
Zfp229 A G 17: 21,965,615 (GRCm39) E615G probably damaging Het
Zfp655 T A 5: 145,180,867 (GRCm39) S242T possibly damaging Het
Zfp788 T A 7: 41,297,705 (GRCm39) F62I possibly damaging Het
Zmynd8 A G 2: 165,629,078 (GRCm39) probably null Het
Other mutations in Stxbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Stxbp2 APN 8 3,686,354 (GRCm39) critical splice acceptor site probably null
IGL00466:Stxbp2 APN 8 3,684,065 (GRCm39) missense probably benign 0.29
IGL02315:Stxbp2 APN 8 3,685,607 (GRCm39) unclassified probably benign
IGL02508:Stxbp2 APN 8 3,682,531 (GRCm39) missense probably damaging 1.00
IGL02811:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02833:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02868:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02869:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02896:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02926:Stxbp2 APN 8 3,685,629 (GRCm39) missense probably benign 0.31
IGL02927:Stxbp2 APN 8 3,692,685 (GRCm39) missense possibly damaging 0.95
IGL02928:Stxbp2 APN 8 3,691,736 (GRCm39) missense probably damaging 0.99
IGL02943:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02945:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02948:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02951:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02972:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02976:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02977:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02983:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL02993:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL03008:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL03009:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL03038:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL03051:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL03061:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL03072:Stxbp2 APN 8 3,691,971 (GRCm39) missense probably benign 0.44
IGL03110:Stxbp2 APN 8 3,683,342 (GRCm39) missense probably damaging 1.00
IGL02988:Stxbp2 UTSW 8 3,683,267 (GRCm39) intron probably benign
R0463:Stxbp2 UTSW 8 3,682,559 (GRCm39) missense probably damaging 1.00
R0755:Stxbp2 UTSW 8 3,692,019 (GRCm39) missense probably benign 0.01
R1328:Stxbp2 UTSW 8 3,692,657 (GRCm39) missense possibly damaging 0.56
R1771:Stxbp2 UTSW 8 3,684,064 (GRCm39) missense probably benign 0.01
R1962:Stxbp2 UTSW 8 3,692,672 (GRCm39) missense probably benign 0.00
R2195:Stxbp2 UTSW 8 3,684,615 (GRCm39) splice site probably null
R2319:Stxbp2 UTSW 8 3,683,834 (GRCm39) missense possibly damaging 0.95
R3614:Stxbp2 UTSW 8 3,681,196 (GRCm39) missense possibly damaging 0.94
R3870:Stxbp2 UTSW 8 3,684,079 (GRCm39) missense probably damaging 1.00
R3876:Stxbp2 UTSW 8 3,683,369 (GRCm39) critical splice donor site probably null
R4703:Stxbp2 UTSW 8 3,682,521 (GRCm39) missense probably damaging 1.00
R6533:Stxbp2 UTSW 8 3,692,683 (GRCm39) missense probably benign 0.01
R6623:Stxbp2 UTSW 8 3,682,561 (GRCm39) missense probably damaging 1.00
R6665:Stxbp2 UTSW 8 3,691,998 (GRCm39) missense probably benign 0.41
R6798:Stxbp2 UTSW 8 3,691,180 (GRCm39) missense probably benign
R7152:Stxbp2 UTSW 8 3,682,583 (GRCm39) missense probably benign 0.33
R7326:Stxbp2 UTSW 8 3,691,151 (GRCm39) missense
R8237:Stxbp2 UTSW 8 3,685,695 (GRCm39) missense
R8268:Stxbp2 UTSW 8 3,682,234 (GRCm39) missense
R8709:Stxbp2 UTSW 8 3,683,914 (GRCm39) missense possibly damaging 0.50
R8811:Stxbp2 UTSW 8 3,689,541 (GRCm39) missense
R9018:Stxbp2 UTSW 8 3,692,627 (GRCm39) intron probably benign
R9043:Stxbp2 UTSW 8 3,684,478 (GRCm39) missense
R9048:Stxbp2 UTSW 8 3,687,218 (GRCm39) missense
R9212:Stxbp2 UTSW 8 3,686,220 (GRCm39) missense
R9421:Stxbp2 UTSW 8 3,682,264 (GRCm39) missense
R9643:Stxbp2 UTSW 8 3,686,392 (GRCm39) missense
Z1177:Stxbp2 UTSW 8 3,691,123 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTATGCAGTGCCCCAGGCTATG -3'
(R):5'- AGTGAGGCTGACCCTTTAGGGATTG -3'

Sequencing Primer
(F):5'- ATGAGAGTTGCCTCCAGAATTCC -3'
(R):5'- TGTAATCAGGAAATCCTACATGGAAG -3'
Posted On 2013-07-11