Incidental Mutation 'R6995:Kirrel2'
ID544126
Institutional Source Beutler Lab
Gene Symbol Kirrel2
Ensembl Gene ENSMUSG00000036915
Gene Namekirre like nephrin family adhesion molecule 2
SynonymsC330019F22Rik, NEPH3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R6995 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location30447534-30457690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30455179 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 169 (F169C)
Ref Sequence ENSEMBL: ENSMUSP00000039395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000045817] [ENSMUST00000126297]
Predicted Effect probably benign
Transcript: ENSMUST00000006825
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000045817
AA Change: F169C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039395
Gene: ENSMUSG00000036915
AA Change: F169C

DomainStartEndE-ValueType
IG 27 117 9.18e-12 SMART
IG 128 219 5.13e-1 SMART
IG_like 230 306 8.06e0 SMART
IGc2 321 379 3.06e-8 SMART
IG_like 401 500 4.65e1 SMART
transmembrane domain 509 531 N/A INTRINSIC
low complexity region 547 565 N/A INTRINSIC
low complexity region 607 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126297
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000131161
Gene: ENSMUSG00000036915
AA Change: F103C

DomainStartEndE-ValueType
IG 27 117 9.18e-12 SMART
IG_like 118 189 5.91e-1 SMART
IG_like 211 287 8.06e0 SMART
IGc2 302 360 3.06e-8 SMART
IG_like 382 481 4.65e1 SMART
transmembrane domain 490 512 N/A INTRINSIC
low complexity region 528 546 N/A INTRINSIC
low complexity region 588 610 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170152
SMART Domains Protein: ENSMUSP00000132652
Gene: ENSMUSG00000036915

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane protein and member of the immunoglobulin superfamily of cell adhesion molecules. The encoded protein localizes to adherens junctions in pancreatic beta cells and regulates insulin secretion. Autoantibodies against the encoded protein have been detected in serum from patients with type 1 diabetes. This gene may also play a role in glomerular development and decreased expression of this gene has been observed in human glomerular diseases. This gene and the related opposite-strand gene nephrin (GeneID: 527362) are regulated by a bidirectional promoter. [provided by RefSeq, Jul 2016]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A G 7: 40,994,725 Y606C probably benign Het
5430419D17Rik G T 7: 131,222,671 W165L probably damaging Het
5830411N06Rik G A 7: 140,261,601 D273N probably benign Het
Acad9 A G 3: 36,085,481 Y410C probably damaging Het
Acot6 C T 12: 84,109,375 P366S probably damaging Het
Anks1 G T 17: 28,054,299 G964V probably damaging Het
Apol7a A T 15: 77,389,976 probably benign Het
Arid3c G A 4: 41,725,087 A320V probably damaging Het
Bnip3l A T 14: 66,999,652 N50K probably benign Het
C130060K24Rik A T 6: 65,441,301 K151I probably damaging Het
C1qtnf4 C A 2: 90,889,953 A190D probably benign Het
Cdh1 G T 8: 106,660,913 V482L probably benign Het
Cdrt4 A C 11: 62,992,660 I63L probably benign Het
Cic A T 7: 25,271,311 T156S possibly damaging Het
Ckm A G 7: 19,420,231 N301S probably benign Het
Colgalt1 C T 8: 71,623,521 R539C probably damaging Het
Cop1 A G 1: 159,306,584 D132G probably damaging Het
Cpd G T 11: 76,785,055 N1257K probably benign Het
Cyp2c67 T C 19: 39,615,679 H411R probably damaging Het
Cyp2r1 A T 7: 114,553,081 F5I probably damaging Het
Dclk3 T A 9: 111,467,700 L104Q possibly damaging Het
Dnah7c A T 1: 46,455,813 Q67L probably benign Het
Dnm1l C A 16: 16,329,807 E365* probably null Het
Dst A T 1: 34,166,234 I502F probably damaging Het
Espl1 T C 15: 102,304,100 V547A possibly damaging Het
Fam26e A T 10: 34,096,193 M82K probably benign Het
Foxa1 C T 12: 57,542,478 A319T probably benign Het
Frem1 G T 4: 82,986,601 H859N probably damaging Het
Frem3 T A 8: 80,612,579 D500E probably damaging Het
Gm9774 T C 3: 92,429,008 probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grip1 A G 10: 119,986,470 D394G probably damaging Het
Gsap C A 5: 21,271,237 T589K possibly damaging Het
Gsg1l A G 7: 125,923,486 V190A probably damaging Het
Kcnmb1 A T 11: 33,970,131 T115S probably benign Het
L3mbtl1 C T 2: 162,961,448 T397M probably damaging Het
Lama1 G A 17: 67,753,825 C716Y Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Lrig1 T C 6: 94,611,629 D513G possibly damaging Het
Lrrk1 T C 7: 66,292,342 D716G probably damaging Het
Matn4 G A 2: 164,389,664 R582* probably null Het
Mdn1 A T 4: 32,733,374 R3133W probably benign Het
Mmp7 A G 9: 7,695,488 D122G probably damaging Het
Naaladl1 A G 19: 6,115,548 D744G possibly damaging Het
Nampt T G 12: 32,848,743 Y453D probably benign Het
Nlrp12 A G 7: 3,239,851 V677A probably benign Het
Ntng2 T C 2: 29,197,068 N414S probably damaging Het
Olfr1 A G 11: 73,395,584 V146A probably benign Het
Olfr1160 A C 2: 88,006,185 F189V probably benign Het
Olfr1284 A G 2: 111,379,363 D121G probably damaging Het
Olfr472 A G 7: 107,903,622 R302G probably benign Het
Parp4 A C 14: 56,613,739 Q733P probably damaging Het
Pdcl3 G A 1: 38,995,336 V56I probably benign Het
Pepd A G 7: 35,021,719 Y256C probably damaging Het
Plg G T 17: 12,419,051 R788L probably benign Het
Plod1 A T 4: 147,916,218 probably benign Het
Ptprc A G 1: 138,088,744 V513A probably damaging Het
Pxdn T C 12: 29,995,371 I373T possibly damaging Het
Rbbp8 G A 18: 11,718,908 G262E probably damaging Het
Rfc2 T A 5: 134,594,250 Y240* probably null Het
Rps15 A G 10: 80,293,764 E71G possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr1 A C 7: 29,094,182 M1287R probably damaging Het
Serpina9 A G 12: 104,001,236 L300P probably damaging Het
Sh3rf2 G A 18: 42,101,541 A130T probably damaging Het
Slc12a8 G A 16: 33,534,893 W26* probably null Het
Snx18 A T 13: 113,594,729 H576Q probably damaging Het
Tagln3 G A 16: 45,722,958 T107I probably benign Het
Thap1 C A 8: 26,162,651 T139K probably damaging Het
Tle4 T A 19: 14,564,453 probably null Het
Tmem87a A T 2: 120,362,928 M502K possibly damaging Het
Tpcn2 A T 7: 145,256,785 V605E probably benign Het
Trgj1 C A 13: 19,210,359 probably benign Het
Tsc2 A T 17: 24,628,054 V179E probably damaging Het
Ubap2l T C 3: 90,009,241 T909A probably damaging Het
Ubl4b T G 3: 107,554,824 Q40P probably damaging Het
Vmn1r229 A G 17: 20,815,015 D174G probably damaging Het
Vmn2r50 A T 7: 10,046,037 Y472* probably null Het
Vmn2r74 T A 7: 85,952,735 D565V probably benign Het
Vmn2r74 T A 7: 85,957,652 probably null Het
Vmn2r82 T A 10: 79,396,543 V792E probably damaging Het
Zfp335 G A 2: 164,893,290 Q1179* probably null Het
Zmynd12 A C 4: 119,453,575 K327Q probably benign Het
Zwilch G A 9: 64,165,449 Q27* probably null Het
Other mutations in Kirrel2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Kirrel2 APN 7 30453664 missense probably benign 0.03
IGL02457:Kirrel2 APN 7 30452740 missense probably damaging 1.00
IGL02609:Kirrel2 APN 7 30448340 missense probably benign 0.00
R0029:Kirrel2 UTSW 7 30453165 unclassified probably benign
R0395:Kirrel2 UTSW 7 30450458 missense possibly damaging 0.68
R0987:Kirrel2 UTSW 7 30448130 missense probably damaging 1.00
R1511:Kirrel2 UTSW 7 30456498 missense probably damaging 1.00
R2226:Kirrel2 UTSW 7 30454154 missense probably damaging 1.00
R4818:Kirrel2 UTSW 7 30449868 missense probably benign 0.32
R4963:Kirrel2 UTSW 7 30450801 critical splice donor site probably null
R6918:Kirrel2 UTSW 7 30450814 missense probably damaging 1.00
R6985:Kirrel2 UTSW 7 30455306 missense probably damaging 1.00
R7014:Kirrel2 UTSW 7 30454574 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGTATTATTACCACACCTCACAC -3'
(R):5'- CCCAGATCTACTATGCAGTCCC -3'

Sequencing Primer
(F):5'- CTTGGATACTTTTAGTCACTCACATG -3'
(R):5'- CCCCAGAAGCTCCCCAGG -3'
Posted On2019-05-13