Incidental Mutation 'R6995:5830411N06Rik'
ID544136
Institutional Source Beutler Lab
Gene Symbol 5830411N06Rik
Ensembl Gene ENSMUSG00000054672
Gene NameRIKEN cDNA 5830411N06 gene
SynonymsScart2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6995 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location140247284-140300736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140261601 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 273 (D273N)
Ref Sequence ENSEMBL: ENSMUSP00000131905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]
Predicted Effect probably benign
Transcript: ENSMUST00000093984
SMART Domains Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
SR 446 546 8.78e-30 SMART
SR 551 651 1.26e-53 SMART
SR 656 756 2.88e-16 SMART
SR 783 883 7.62e-48 SMART
transmembrane domain 903 925 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164583
AA Change: D273N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: D273N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
Blast:SR 291 349 5e-12 BLAST
SR 354 452 1.65e-34 SMART
SR 456 556 4.53e-32 SMART
SR 562 662 8.78e-30 SMART
SR 667 767 1.26e-53 SMART
SR 772 872 2.88e-16 SMART
SR 899 999 7.62e-48 SMART
transmembrane domain 1019 1041 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A G 7: 40,994,725 Y606C probably benign Het
5430419D17Rik G T 7: 131,222,671 W165L probably damaging Het
Acad9 A G 3: 36,085,481 Y410C probably damaging Het
Acot6 C T 12: 84,109,375 P366S probably damaging Het
Anks1 G T 17: 28,054,299 G964V probably damaging Het
Apol7a A T 15: 77,389,976 probably benign Het
Arid3c G A 4: 41,725,087 A320V probably damaging Het
Bnip3l A T 14: 66,999,652 N50K probably benign Het
C130060K24Rik A T 6: 65,441,301 K151I probably damaging Het
C1qtnf4 C A 2: 90,889,953 A190D probably benign Het
Cdh1 G T 8: 106,660,913 V482L probably benign Het
Cdrt4 A C 11: 62,992,660 I63L probably benign Het
Cic A T 7: 25,271,311 T156S possibly damaging Het
Ckm A G 7: 19,420,231 N301S probably benign Het
Colgalt1 C T 8: 71,623,521 R539C probably damaging Het
Cop1 A G 1: 159,306,584 D132G probably damaging Het
Cpd G T 11: 76,785,055 N1257K probably benign Het
Cyp2c67 T C 19: 39,615,679 H411R probably damaging Het
Cyp2r1 A T 7: 114,553,081 F5I probably damaging Het
Dclk3 T A 9: 111,467,700 L104Q possibly damaging Het
Dnah7c A T 1: 46,455,813 Q67L probably benign Het
Dnm1l C A 16: 16,329,807 E365* probably null Het
Dst A T 1: 34,166,234 I502F probably damaging Het
Espl1 T C 15: 102,304,100 V547A possibly damaging Het
Fam26e A T 10: 34,096,193 M82K probably benign Het
Foxa1 C T 12: 57,542,478 A319T probably benign Het
Frem1 G T 4: 82,986,601 H859N probably damaging Het
Frem3 T A 8: 80,612,579 D500E probably damaging Het
Gm9774 T C 3: 92,429,008 probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grip1 A G 10: 119,986,470 D394G probably damaging Het
Gsap C A 5: 21,271,237 T589K possibly damaging Het
Gsg1l A G 7: 125,923,486 V190A probably damaging Het
Kcnmb1 A T 11: 33,970,131 T115S probably benign Het
Kirrel2 A C 7: 30,455,179 F169C probably damaging Het
L3mbtl1 C T 2: 162,961,448 T397M probably damaging Het
Lama1 G A 17: 67,753,825 C716Y Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Lrig1 T C 6: 94,611,629 D513G possibly damaging Het
Lrrk1 T C 7: 66,292,342 D716G probably damaging Het
Matn4 G A 2: 164,389,664 R582* probably null Het
Mdn1 A T 4: 32,733,374 R3133W probably benign Het
Mmp7 A G 9: 7,695,488 D122G probably damaging Het
Naaladl1 A G 19: 6,115,548 D744G possibly damaging Het
Nampt T G 12: 32,848,743 Y453D probably benign Het
Nlrp12 A G 7: 3,239,851 V677A probably benign Het
Ntng2 T C 2: 29,197,068 N414S probably damaging Het
Olfr1 A G 11: 73,395,584 V146A probably benign Het
Olfr1160 A C 2: 88,006,185 F189V probably benign Het
Olfr1284 A G 2: 111,379,363 D121G probably damaging Het
Olfr472 A G 7: 107,903,622 R302G probably benign Het
Parp4 A C 14: 56,613,739 Q733P probably damaging Het
Pdcl3 G A 1: 38,995,336 V56I probably benign Het
Pepd A G 7: 35,021,719 Y256C probably damaging Het
Plg G T 17: 12,419,051 R788L probably benign Het
Plod1 A T 4: 147,916,218 probably benign Het
Ptprc A G 1: 138,088,744 V513A probably damaging Het
Pxdn T C 12: 29,995,371 I373T possibly damaging Het
Rbbp8 G A 18: 11,718,908 G262E probably damaging Het
Rfc2 T A 5: 134,594,250 Y240* probably null Het
Rps15 A G 10: 80,293,764 E71G possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr1 A C 7: 29,094,182 M1287R probably damaging Het
Serpina9 A G 12: 104,001,236 L300P probably damaging Het
Sh3rf2 G A 18: 42,101,541 A130T probably damaging Het
Slc12a8 G A 16: 33,534,893 W26* probably null Het
Snx18 A T 13: 113,594,729 H576Q probably damaging Het
Tagln3 G A 16: 45,722,958 T107I probably benign Het
Thap1 C A 8: 26,162,651 T139K probably damaging Het
Tle4 T A 19: 14,564,453 probably null Het
Tmem87a A T 2: 120,362,928 M502K possibly damaging Het
Tpcn2 A T 7: 145,256,785 V605E probably benign Het
Trgj1 C A 13: 19,210,359 probably benign Het
Tsc2 A T 17: 24,628,054 V179E probably damaging Het
Ubap2l T C 3: 90,009,241 T909A probably damaging Het
Ubl4b T G 3: 107,554,824 Q40P probably damaging Het
Vmn1r229 A G 17: 20,815,015 D174G probably damaging Het
Vmn2r50 A T 7: 10,046,037 Y472* probably null Het
Vmn2r74 T A 7: 85,952,735 D565V probably benign Het
Vmn2r74 T A 7: 85,957,652 probably null Het
Vmn2r82 T A 10: 79,396,543 V792E probably damaging Het
Zfp335 G A 2: 164,893,290 Q1179* probably null Het
Zmynd12 A C 4: 119,453,575 K327Q probably benign Het
Zwilch G A 9: 64,165,449 Q27* probably null Het
Other mutations in 5830411N06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:5830411N06Rik APN 7 140294842 missense probably damaging 0.99
IGL01101:5830411N06Rik APN 7 140296104 missense probably benign 0.35
IGL01120:5830411N06Rik APN 7 140296559 missense probably benign 0.02
IGL01958:5830411N06Rik APN 7 140274127 missense probably damaging 1.00
IGL02150:5830411N06Rik APN 7 140297859 missense possibly damaging 0.84
IGL02193:5830411N06Rik APN 7 140249000 missense probably benign 0.17
IGL02239:5830411N06Rik APN 7 140295843 missense probably damaging 1.00
IGL02335:5830411N06Rik APN 7 140296540 missense probably damaging 1.00
IGL02569:5830411N06Rik APN 7 140298362 missense probably benign 0.01
IGL02993:5830411N06Rik APN 7 140296573 missense probably benign 0.07
IGL03261:5830411N06Rik APN 7 140294833 missense probably benign 0.00
IGL03365:5830411N06Rik APN 7 140296769 missense probably damaging 1.00
IGL03399:5830411N06Rik APN 7 140247956 missense probably benign 0.00
IGL03052:5830411N06Rik UTSW 7 140248914 missense probably damaging 1.00
PIT4791001:5830411N06Rik UTSW 7 140274062 missense possibly damaging 0.53
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0347:5830411N06Rik UTSW 7 140297854 missense probably damaging 1.00
R0374:5830411N06Rik UTSW 7 140248961 missense probably damaging 1.00
R0639:5830411N06Rik UTSW 7 140247959 missense probably benign 0.01
R0667:5830411N06Rik UTSW 7 140261537 missense possibly damaging 0.73
R0789:5830411N06Rik UTSW 7 140248220 missense probably damaging 1.00
R0959:5830411N06Rik UTSW 7 140294791 missense probably damaging 1.00
R1316:5830411N06Rik UTSW 7 140299670 missense probably benign 0.09
R1764:5830411N06Rik UTSW 7 140297265 missense probably benign 0.00
R2247:5830411N06Rik UTSW 7 140249129 missense probably null 0.96
R2379:5830411N06Rik UTSW 7 140299769 missense probably benign 0.15
R4112:5830411N06Rik UTSW 7 140298368 nonsense probably null
R4114:5830411N06Rik UTSW 7 140297910 missense probably damaging 1.00
R4346:5830411N06Rik UTSW 7 140247965 missense probably damaging 0.97
R4836:5830411N06Rik UTSW 7 140299108 missense probably benign
R4956:5830411N06Rik UTSW 7 140298362 missense probably benign 0.00
R5208:5830411N06Rik UTSW 7 140298036 missense probably benign 0.00
R5571:5830411N06Rik UTSW 7 140249123 missense probably damaging 1.00
R5583:5830411N06Rik UTSW 7 140296826 missense probably damaging 1.00
R5645:5830411N06Rik UTSW 7 140248940 missense possibly damaging 0.95
R6183:5830411N06Rik UTSW 7 140296034 missense possibly damaging 0.82
R7436:5830411N06Rik UTSW 7 140261607 missense probably benign
R7621:5830411N06Rik UTSW 7 140296829 missense probably damaging 1.00
R7662:5830411N06Rik UTSW 7 140294812 missense possibly damaging 0.58
R7669:5830411N06Rik UTSW 7 140296321 missense possibly damaging 0.47
R7686:5830411N06Rik UTSW 7 140249052 missense probably benign 0.00
R7985:5830411N06Rik UTSW 7 140296893 missense probably damaging 1.00
R8330:5830411N06Rik UTSW 7 140296318 nonsense probably null
R8843:5830411N06Rik UTSW 7 140249000 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGGTGACAGATGACAGCTC -3'
(R):5'- TTGTGCTAGCATTAAGACAGTCAC -3'

Sequencing Primer
(F):5'- TGACAGATGACAGCTCTGATGTG -3'
(R):5'- CACACACATGAACCTTAGG -3'
Posted On2019-05-13