Incidental Mutation 'R6995:Zwilch'
ID544143
Institutional Source Beutler Lab
Gene Symbol Zwilch
Ensembl Gene ENSMUSG00000032400
Gene Namezwilch kinetochore protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6995 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location64137144-64173104 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 64165449 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 27 (Q27*)
Ref Sequence ENSEMBL: ENSMUSP00000135328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122091] [ENSMUST00000130127] [ENSMUST00000176299] [ENSMUST00000176378] [ENSMUST00000176794] [ENSMUST00000177045]
Predicted Effect probably null
Transcript: ENSMUST00000122091
AA Change: Q46*
SMART Domains Protein: ENSMUSP00000112790
Gene: ENSMUSG00000032400
AA Change: Q46*

DomainStartEndE-ValueType
Pfam:DUF2352 38 589 6e-206 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124301
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000134966
Gene: ENSMUSG00000032400
AA Change: Q45*

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 3e-31 PDB
Predicted Effect probably null
Transcript: ENSMUST00000130127
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000116187
Gene: ENSMUSG00000032400
AA Change: Q45*

DomainStartEndE-ValueType
Pfam:DUF2352 72 154 8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176299
SMART Domains Protein: ENSMUSP00000135585
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 1 471 2.9e-192 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176378
AA Change: Q46*
SMART Domains Protein: ENSMUSP00000134782
Gene: ENSMUSG00000032400
AA Change: Q46*

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 1e-31 PDB
Predicted Effect probably null
Transcript: ENSMUST00000176794
AA Change: Q46*
SMART Domains Protein: ENSMUSP00000134850
Gene: ENSMUSG00000032400
AA Change: Q46*

DomainStartEndE-ValueType
Pfam:DUF2352 38 257 8e-67 PFAM
Pfam:DUF2352 254 568 4.4e-131 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177045
AA Change: Q27*
SMART Domains Protein: ENSMUSP00000135328
Gene: ENSMUSG00000032400
AA Change: Q27*

DomainStartEndE-ValueType
Pfam:DUF2352 19 303 2.2e-93 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A G 7: 40,994,725 Y606C probably benign Het
5430419D17Rik G T 7: 131,222,671 W165L probably damaging Het
5830411N06Rik G A 7: 140,261,601 D273N probably benign Het
Acad9 A G 3: 36,085,481 Y410C probably damaging Het
Acot6 C T 12: 84,109,375 P366S probably damaging Het
Anks1 G T 17: 28,054,299 G964V probably damaging Het
Apol7a A T 15: 77,389,976 probably benign Het
Arid3c G A 4: 41,725,087 A320V probably damaging Het
Bnip3l A T 14: 66,999,652 N50K probably benign Het
C130060K24Rik A T 6: 65,441,301 K151I probably damaging Het
C1qtnf4 C A 2: 90,889,953 A190D probably benign Het
Cdh1 G T 8: 106,660,913 V482L probably benign Het
Cdrt4 A C 11: 62,992,660 I63L probably benign Het
Cic A T 7: 25,271,311 T156S possibly damaging Het
Ckm A G 7: 19,420,231 N301S probably benign Het
Colgalt1 C T 8: 71,623,521 R539C probably damaging Het
Cop1 A G 1: 159,306,584 D132G probably damaging Het
Cpd G T 11: 76,785,055 N1257K probably benign Het
Cyp2c67 T C 19: 39,615,679 H411R probably damaging Het
Cyp2r1 A T 7: 114,553,081 F5I probably damaging Het
Dclk3 T A 9: 111,467,700 L104Q possibly damaging Het
Dnah7c A T 1: 46,455,813 Q67L probably benign Het
Dnm1l C A 16: 16,329,807 E365* probably null Het
Dst A T 1: 34,166,234 I502F probably damaging Het
Espl1 T C 15: 102,304,100 V547A possibly damaging Het
Fam26e A T 10: 34,096,193 M82K probably benign Het
Foxa1 C T 12: 57,542,478 A319T probably benign Het
Frem1 G T 4: 82,986,601 H859N probably damaging Het
Frem3 T A 8: 80,612,579 D500E probably damaging Het
Gm9774 T C 3: 92,429,008 probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grip1 A G 10: 119,986,470 D394G probably damaging Het
Gsap C A 5: 21,271,237 T589K possibly damaging Het
Gsg1l A G 7: 125,923,486 V190A probably damaging Het
Kcnmb1 A T 11: 33,970,131 T115S probably benign Het
Kirrel2 A C 7: 30,455,179 F169C probably damaging Het
L3mbtl1 C T 2: 162,961,448 T397M probably damaging Het
Lama1 G A 17: 67,753,825 C716Y Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Lrig1 T C 6: 94,611,629 D513G possibly damaging Het
Lrrk1 T C 7: 66,292,342 D716G probably damaging Het
Matn4 G A 2: 164,389,664 R582* probably null Het
Mdn1 A T 4: 32,733,374 R3133W probably benign Het
Mmp7 A G 9: 7,695,488 D122G probably damaging Het
Naaladl1 A G 19: 6,115,548 D744G possibly damaging Het
Nampt T G 12: 32,848,743 Y453D probably benign Het
Nlrp12 A G 7: 3,239,851 V677A probably benign Het
Ntng2 T C 2: 29,197,068 N414S probably damaging Het
Olfr1 A G 11: 73,395,584 V146A probably benign Het
Olfr1160 A C 2: 88,006,185 F189V probably benign Het
Olfr1284 A G 2: 111,379,363 D121G probably damaging Het
Olfr472 A G 7: 107,903,622 R302G probably benign Het
Parp4 A C 14: 56,613,739 Q733P probably damaging Het
Pdcl3 G A 1: 38,995,336 V56I probably benign Het
Pepd A G 7: 35,021,719 Y256C probably damaging Het
Plg G T 17: 12,419,051 R788L probably benign Het
Plod1 A T 4: 147,916,218 probably benign Het
Ptprc A G 1: 138,088,744 V513A probably damaging Het
Pxdn T C 12: 29,995,371 I373T possibly damaging Het
Rbbp8 G A 18: 11,718,908 G262E probably damaging Het
Rfc2 T A 5: 134,594,250 Y240* probably null Het
Rps15 A G 10: 80,293,764 E71G possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr1 A C 7: 29,094,182 M1287R probably damaging Het
Serpina9 A G 12: 104,001,236 L300P probably damaging Het
Sh3rf2 G A 18: 42,101,541 A130T probably damaging Het
Slc12a8 G A 16: 33,534,893 W26* probably null Het
Snx18 A T 13: 113,594,729 H576Q probably damaging Het
Tagln3 G A 16: 45,722,958 T107I probably benign Het
Thap1 C A 8: 26,162,651 T139K probably damaging Het
Tle4 T A 19: 14,564,453 probably null Het
Tmem87a A T 2: 120,362,928 M502K possibly damaging Het
Tpcn2 A T 7: 145,256,785 V605E probably benign Het
Trgj1 C A 13: 19,210,359 probably benign Het
Tsc2 A T 17: 24,628,054 V179E probably damaging Het
Ubap2l T C 3: 90,009,241 T909A probably damaging Het
Ubl4b T G 3: 107,554,824 Q40P probably damaging Het
Vmn1r229 A G 17: 20,815,015 D174G probably damaging Het
Vmn2r50 A T 7: 10,046,037 Y472* probably null Het
Vmn2r74 T A 7: 85,952,735 D565V probably benign Het
Vmn2r74 T A 7: 85,957,652 probably null Het
Vmn2r82 T A 10: 79,396,543 V792E probably damaging Het
Zfp335 G A 2: 164,893,290 Q1179* probably null Het
Zmynd12 A C 4: 119,453,575 K327Q probably benign Het
Other mutations in Zwilch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02315:Zwilch APN 9 64150267 missense probably damaging 1.00
IGL02365:Zwilch APN 9 64160924 missense probably damaging 1.00
IGL02733:Zwilch APN 9 64146836 missense probably benign 0.12
IGL02818:Zwilch APN 9 64150227 missense probably damaging 0.99
R1171:Zwilch UTSW 9 64158717 missense possibly damaging 0.56
R1913:Zwilch UTSW 9 64160952 missense probably damaging 1.00
R2079:Zwilch UTSW 9 64153574 missense probably damaging 1.00
R2079:Zwilch UTSW 9 64153575 missense probably damaging 1.00
R3772:Zwilch UTSW 9 64156034 missense probably benign 0.03
R4171:Zwilch UTSW 9 64158715 nonsense probably null
R4298:Zwilch UTSW 9 64155162 critical splice donor site probably null
R4299:Zwilch UTSW 9 64155162 critical splice donor site probably null
R4901:Zwilch UTSW 9 64162746 missense probably damaging 1.00
R5106:Zwilch UTSW 9 64153584 missense probably damaging 1.00
R5208:Zwilch UTSW 9 64152923 missense probably benign 0.00
R5215:Zwilch UTSW 9 64146874 missense probably benign
R5413:Zwilch UTSW 9 64168610 splice site probably null
R5865:Zwilch UTSW 9 64172908 start gained probably null
R6221:Zwilch UTSW 9 64161383 missense probably damaging 1.00
R6858:Zwilch UTSW 9 64153587 missense probably damaging 1.00
R6957:Zwilch UTSW 9 64162562 critical splice donor site probably null
R7104:Zwilch UTSW 9 64161376 missense probably damaging 1.00
R7595:Zwilch UTSW 9 64149264 intron probably benign
R7691:Zwilch UTSW 9 64156091 missense probably benign 0.18
R7743:Zwilch UTSW 9 64152935 missense probably damaging 1.00
R8378:Zwilch UTSW 9 64152958 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTCATTAACAGGAAAACAGTAGCACG -3'
(R):5'- ACATTTTCTGTGTATGTGCATGTAC -3'

Sequencing Primer
(F):5'- GGAAAACAGTAGCACGAAATTATTC -3'
(R):5'- GAGCCCCAGAAGTATCTAGTTTCTG -3'
Posted On2019-05-13