Incidental Mutation 'R6995:Cpd'
ID544152
Institutional Source Beutler Lab
Gene Symbol Cpd
Ensembl Gene ENSMUSG00000020841
Gene Namecarboxypeptidase D
SynonymsD830034L15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R6995 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location76778424-76847018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 76785055 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1257 (N1257K)
Ref Sequence ENSEMBL: ENSMUSP00000021201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021201]
Predicted Effect probably benign
Transcript: ENSMUST00000021201
AA Change: N1257K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000021201
Gene: ENSMUSG00000020841
AA Change: N1257K

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Zn_pept 62 471 1.71e-52 SMART
Zn_pept 502 900 2.11e-66 SMART
Zn_pept 930 1195 1.11e-42 SMART
Pfam:CarboxypepD_reg 1211 1284 3.6e-10 PFAM
transmembrane domain 1297 1319 N/A INTRINSIC
low complexity region 1363 1371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The metallocarboxypeptidase family of enzymes is divided into 2 subfamilies based on sequence similarities. The pancreatic carboxypeptidase-like and the regulatory B-type carboxypeptidase subfamilies. Carboxypeptidase D has been identified as a regulatory B-type carboxypeptidase. CPD is a homolog of duck gp180, a hepatitis B virus-binding protein. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A G 7: 40,994,725 Y606C probably benign Het
5430419D17Rik G T 7: 131,222,671 W165L probably damaging Het
5830411N06Rik G A 7: 140,261,601 D273N probably benign Het
Acad9 A G 3: 36,085,481 Y410C probably damaging Het
Acot6 C T 12: 84,109,375 P366S probably damaging Het
Anks1 G T 17: 28,054,299 G964V probably damaging Het
Apol7a A T 15: 77,389,976 probably benign Het
Arid3c G A 4: 41,725,087 A320V probably damaging Het
Bnip3l A T 14: 66,999,652 N50K probably benign Het
C130060K24Rik A T 6: 65,441,301 K151I probably damaging Het
C1qtnf4 C A 2: 90,889,953 A190D probably benign Het
Cdh1 G T 8: 106,660,913 V482L probably benign Het
Cdrt4 A C 11: 62,992,660 I63L probably benign Het
Cic A T 7: 25,271,311 T156S possibly damaging Het
Ckm A G 7: 19,420,231 N301S probably benign Het
Colgalt1 C T 8: 71,623,521 R539C probably damaging Het
Cop1 A G 1: 159,306,584 D132G probably damaging Het
Cyp2c67 T C 19: 39,615,679 H411R probably damaging Het
Cyp2r1 A T 7: 114,553,081 F5I probably damaging Het
Dclk3 T A 9: 111,467,700 L104Q possibly damaging Het
Dnah7c A T 1: 46,455,813 Q67L probably benign Het
Dnm1l C A 16: 16,329,807 E365* probably null Het
Dst A T 1: 34,166,234 I502F probably damaging Het
Espl1 T C 15: 102,304,100 V547A possibly damaging Het
Fam26e A T 10: 34,096,193 M82K probably benign Het
Foxa1 C T 12: 57,542,478 A319T probably benign Het
Frem1 G T 4: 82,986,601 H859N probably damaging Het
Frem3 T A 8: 80,612,579 D500E probably damaging Het
Gm9774 T C 3: 92,429,008 probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grip1 A G 10: 119,986,470 D394G probably damaging Het
Gsap C A 5: 21,271,237 T589K possibly damaging Het
Gsg1l A G 7: 125,923,486 V190A probably damaging Het
Kcnmb1 A T 11: 33,970,131 T115S probably benign Het
Kirrel2 A C 7: 30,455,179 F169C probably damaging Het
L3mbtl1 C T 2: 162,961,448 T397M probably damaging Het
Lama1 G A 17: 67,753,825 C716Y Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Lrig1 T C 6: 94,611,629 D513G possibly damaging Het
Lrrk1 T C 7: 66,292,342 D716G probably damaging Het
Matn4 G A 2: 164,389,664 R582* probably null Het
Mdn1 A T 4: 32,733,374 R3133W probably benign Het
Mmp7 A G 9: 7,695,488 D122G probably damaging Het
Naaladl1 A G 19: 6,115,548 D744G possibly damaging Het
Nampt T G 12: 32,848,743 Y453D probably benign Het
Nlrp12 A G 7: 3,239,851 V677A probably benign Het
Ntng2 T C 2: 29,197,068 N414S probably damaging Het
Olfr1 A G 11: 73,395,584 V146A probably benign Het
Olfr1160 A C 2: 88,006,185 F189V probably benign Het
Olfr1284 A G 2: 111,379,363 D121G probably damaging Het
Olfr472 A G 7: 107,903,622 R302G probably benign Het
Parp4 A C 14: 56,613,739 Q733P probably damaging Het
Pdcl3 G A 1: 38,995,336 V56I probably benign Het
Pepd A G 7: 35,021,719 Y256C probably damaging Het
Plg G T 17: 12,419,051 R788L probably benign Het
Plod1 A T 4: 147,916,218 probably benign Het
Ptprc A G 1: 138,088,744 V513A probably damaging Het
Pxdn T C 12: 29,995,371 I373T possibly damaging Het
Rbbp8 G A 18: 11,718,908 G262E probably damaging Het
Rfc2 T A 5: 134,594,250 Y240* probably null Het
Rps15 A G 10: 80,293,764 E71G possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr1 A C 7: 29,094,182 M1287R probably damaging Het
Serpina9 A G 12: 104,001,236 L300P probably damaging Het
Sh3rf2 G A 18: 42,101,541 A130T probably damaging Het
Slc12a8 G A 16: 33,534,893 W26* probably null Het
Snx18 A T 13: 113,594,729 H576Q probably damaging Het
Tagln3 G A 16: 45,722,958 T107I probably benign Het
Thap1 C A 8: 26,162,651 T139K probably damaging Het
Tle4 T A 19: 14,564,453 probably null Het
Tmem87a A T 2: 120,362,928 M502K possibly damaging Het
Tpcn2 A T 7: 145,256,785 V605E probably benign Het
Trgj1 C A 13: 19,210,359 probably benign Het
Tsc2 A T 17: 24,628,054 V179E probably damaging Het
Ubap2l T C 3: 90,009,241 T909A probably damaging Het
Ubl4b T G 3: 107,554,824 Q40P probably damaging Het
Vmn1r229 A G 17: 20,815,015 D174G probably damaging Het
Vmn2r50 A T 7: 10,046,037 Y472* probably null Het
Vmn2r74 T A 7: 85,957,652 probably null Het
Vmn2r74 T A 7: 85,952,735 D565V probably benign Het
Vmn2r82 T A 10: 79,396,543 V792E probably damaging Het
Zfp335 G A 2: 164,893,290 Q1179* probably null Het
Zmynd12 A C 4: 119,453,575 K327Q probably benign Het
Zwilch G A 9: 64,165,449 Q27* probably null Het
Other mutations in Cpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Cpd APN 11 76797789 missense probably benign 0.00
IGL00698:Cpd APN 11 76840444 missense possibly damaging 0.82
IGL01025:Cpd APN 11 76795613 missense probably damaging 1.00
IGL01292:Cpd APN 11 76846245 missense possibly damaging 0.80
IGL01571:Cpd APN 11 76782296 missense probably damaging 1.00
IGL01606:Cpd APN 11 76812640 missense probably benign
IGL02283:Cpd APN 11 76840425 missense probably benign 0.19
IGL02895:Cpd APN 11 76785203 missense probably benign 0.06
IGL02965:Cpd APN 11 76790988 splice site probably benign
IGL03116:Cpd APN 11 76811713 missense probably damaging 1.00
IGL03178:Cpd APN 11 76806051 missense probably benign 0.02
PIT4280001:Cpd UTSW 11 76791024 missense probably benign 0.23
PIT4382001:Cpd UTSW 11 76797788 missense probably benign
R0050:Cpd UTSW 11 76792859 missense possibly damaging 0.94
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0320:Cpd UTSW 11 76840447 missense possibly damaging 0.50
R0416:Cpd UTSW 11 76785204 missense probably benign 0.13
R0556:Cpd UTSW 11 76802345 splice site probably benign
R0666:Cpd UTSW 11 76782327 missense probably damaging 1.00
R0668:Cpd UTSW 11 76784398 missense probably damaging 1.00
R1180:Cpd UTSW 11 76801753 missense possibly damaging 0.56
R1472:Cpd UTSW 11 76784398 missense probably damaging 0.98
R1518:Cpd UTSW 11 76840386 critical splice donor site probably null
R1617:Cpd UTSW 11 76846669 missense probably damaging 1.00
R1786:Cpd UTSW 11 76792798 missense probably benign 0.00
R1854:Cpd UTSW 11 76786338 missense probably damaging 1.00
R1861:Cpd UTSW 11 76784382 splice site probably benign
R2159:Cpd UTSW 11 76797641 missense probably damaging 0.96
R2205:Cpd UTSW 11 76802244 missense probably damaging 0.99
R2281:Cpd UTSW 11 76797801 missense probably benign 0.00
R2680:Cpd UTSW 11 76790999 missense probably benign
R2928:Cpd UTSW 11 76846374 missense probably benign
R2937:Cpd UTSW 11 76811859 missense probably damaging 1.00
R4133:Cpd UTSW 11 76814818 nonsense probably null
R4241:Cpd UTSW 11 76846785 missense probably benign 0.03
R4369:Cpd UTSW 11 76797711 missense possibly damaging 0.82
R4538:Cpd UTSW 11 76790999 missense probably benign
R4551:Cpd UTSW 11 76811886 missense probably damaging 1.00
R4617:Cpd UTSW 11 76840615 missense probably damaging 1.00
R4732:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4733:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4821:Cpd UTSW 11 76846237 missense probably benign 0.38
R4852:Cpd UTSW 11 76785150 missense probably benign 0.32
R4901:Cpd UTSW 11 76790881 missense probably damaging 1.00
R4988:Cpd UTSW 11 76814830 missense probably damaging 0.98
R4999:Cpd UTSW 11 76846222 critical splice donor site probably null
R5005:Cpd UTSW 11 76813570 missense probably damaging 1.00
R5092:Cpd UTSW 11 76811704 missense possibly damaging 0.75
R5438:Cpd UTSW 11 76791966 missense possibly damaging 0.65
R5524:Cpd UTSW 11 76797901 nonsense probably null
R5677:Cpd UTSW 11 76799825 missense probably benign
R5826:Cpd UTSW 11 76784416 nonsense probably null
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6103:Cpd UTSW 11 76799799 missense probably benign 0.00
R6257:Cpd UTSW 11 76812670 missense probably benign 0.37
R6263:Cpd UTSW 11 76846271 missense probably benign 0.00
R6485:Cpd UTSW 11 76808707 splice site probably null
R6671:Cpd UTSW 11 76795533 missense probably damaging 1.00
R7074:Cpd UTSW 11 76813594 missense probably damaging 1.00
R7192:Cpd UTSW 11 76814841 missense probably damaging 1.00
R7341:Cpd UTSW 11 76846953 missense unknown
R7371:Cpd UTSW 11 76846611 missense probably benign 0.25
R7380:Cpd UTSW 11 76802325 nonsense probably null
R7392:Cpd UTSW 11 76801779 missense probably damaging 1.00
R7410:Cpd UTSW 11 76782308 missense probably damaging 1.00
R7509:Cpd UTSW 11 76797876 missense probably benign 0.17
R7767:Cpd UTSW 11 76813559 missense probably benign 0.03
Z1088:Cpd UTSW 11 76801746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATGCAAGTTAGTCTTCTGTTGC -3'
(R):5'- GCCTCAAGCTATTGCCTGTAAAATATC -3'

Sequencing Primer
(F):5'- CAAGTTAGTCTTCTGTTGCTGAGG -3'
(R):5'- GCTATTGCCTGTAAAATATCTGCTG -3'
Posted On2019-05-13