Incidental Mutation 'R6995:Nampt'
ID544154
Institutional Source Beutler Lab
Gene Symbol Nampt
Ensembl Gene ENSMUSG00000020572
Gene Namenicotinamide phosphoribosyltransferase
SynonymsPbef1, 1110035O14Rik, Visfatin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6995 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location32819545-32853349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 32848743 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 453 (Y453D)
Ref Sequence ENSEMBL: ENSMUSP00000020886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020886]
PDB Structure
Crystal Structure of Murine NMPRTase [X-RAY DIFFRACTION]
Crystal Structure of Mouse Nicotinamide Phosphoribosyltransferase/Visfatin/Pre-B Cell Colony Enhancing Factor 1 [X-RAY DIFFRACTION]
Crystal Structure of Mouse Nicotinamide Phosphoribosyltransferase/Visfatin/Pre-B Cell Colony Enhancing Factor in Complex with Nicotinamide Mononuleotide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020886
AA Change: Y453D

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020886
Gene: ENSMUSG00000020572
AA Change: Y453D

DomainStartEndE-ValueType
Pfam:NAPRTase 188 466 1.6e-73 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. The protein belongs to the nicotinic acid phosphoribosyltransferase (NAPRTase) family and is thought to be involved in many important biological processes, including metabolism, stress response and aging. This gene has a pseudogene on chromosome 10. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality prior to E10.5. Mice heterozygous for a null allele exhibit increased fasted glucose in male mice and impaired glucose tolerance and decresed glucose-stimulated insulin secretion in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A G 7: 40,994,725 Y606C probably benign Het
5430419D17Rik G T 7: 131,222,671 W165L probably damaging Het
5830411N06Rik G A 7: 140,261,601 D273N probably benign Het
Acad9 A G 3: 36,085,481 Y410C probably damaging Het
Acot6 C T 12: 84,109,375 P366S probably damaging Het
Anks1 G T 17: 28,054,299 G964V probably damaging Het
Apol7a A T 15: 77,389,976 probably benign Het
Arid3c G A 4: 41,725,087 A320V probably damaging Het
Bnip3l A T 14: 66,999,652 N50K probably benign Het
C130060K24Rik A T 6: 65,441,301 K151I probably damaging Het
C1qtnf4 C A 2: 90,889,953 A190D probably benign Het
Cdh1 G T 8: 106,660,913 V482L probably benign Het
Cdrt4 A C 11: 62,992,660 I63L probably benign Het
Cic A T 7: 25,271,311 T156S possibly damaging Het
Ckm A G 7: 19,420,231 N301S probably benign Het
Colgalt1 C T 8: 71,623,521 R539C probably damaging Het
Cop1 A G 1: 159,306,584 D132G probably damaging Het
Cpd G T 11: 76,785,055 N1257K probably benign Het
Cyp2c67 T C 19: 39,615,679 H411R probably damaging Het
Cyp2r1 A T 7: 114,553,081 F5I probably damaging Het
Dclk3 T A 9: 111,467,700 L104Q possibly damaging Het
Dnah7c A T 1: 46,455,813 Q67L probably benign Het
Dnm1l C A 16: 16,329,807 E365* probably null Het
Dst A T 1: 34,166,234 I502F probably damaging Het
Espl1 T C 15: 102,304,100 V547A possibly damaging Het
Fam26e A T 10: 34,096,193 M82K probably benign Het
Foxa1 C T 12: 57,542,478 A319T probably benign Het
Frem1 G T 4: 82,986,601 H859N probably damaging Het
Frem3 T A 8: 80,612,579 D500E probably damaging Het
Gm9774 T C 3: 92,429,008 probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grip1 A G 10: 119,986,470 D394G probably damaging Het
Gsap C A 5: 21,271,237 T589K possibly damaging Het
Gsg1l A G 7: 125,923,486 V190A probably damaging Het
Kcnmb1 A T 11: 33,970,131 T115S probably benign Het
Kirrel2 A C 7: 30,455,179 F169C probably damaging Het
L3mbtl1 C T 2: 162,961,448 T397M probably damaging Het
Lama1 G A 17: 67,753,825 C716Y Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Lrig1 T C 6: 94,611,629 D513G possibly damaging Het
Lrrk1 T C 7: 66,292,342 D716G probably damaging Het
Matn4 G A 2: 164,389,664 R582* probably null Het
Mdn1 A T 4: 32,733,374 R3133W probably benign Het
Mmp7 A G 9: 7,695,488 D122G probably damaging Het
Naaladl1 A G 19: 6,115,548 D744G possibly damaging Het
Nlrp12 A G 7: 3,239,851 V677A probably benign Het
Ntng2 T C 2: 29,197,068 N414S probably damaging Het
Olfr1 A G 11: 73,395,584 V146A probably benign Het
Olfr1160 A C 2: 88,006,185 F189V probably benign Het
Olfr1284 A G 2: 111,379,363 D121G probably damaging Het
Olfr472 A G 7: 107,903,622 R302G probably benign Het
Parp4 A C 14: 56,613,739 Q733P probably damaging Het
Pdcl3 G A 1: 38,995,336 V56I probably benign Het
Pepd A G 7: 35,021,719 Y256C probably damaging Het
Plg G T 17: 12,419,051 R788L probably benign Het
Plod1 A T 4: 147,916,218 probably benign Het
Ptprc A G 1: 138,088,744 V513A probably damaging Het
Pxdn T C 12: 29,995,371 I373T possibly damaging Het
Rbbp8 G A 18: 11,718,908 G262E probably damaging Het
Rfc2 T A 5: 134,594,250 Y240* probably null Het
Rps15 A G 10: 80,293,764 E71G possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr1 A C 7: 29,094,182 M1287R probably damaging Het
Serpina9 A G 12: 104,001,236 L300P probably damaging Het
Sh3rf2 G A 18: 42,101,541 A130T probably damaging Het
Slc12a8 G A 16: 33,534,893 W26* probably null Het
Snx18 A T 13: 113,594,729 H576Q probably damaging Het
Tagln3 G A 16: 45,722,958 T107I probably benign Het
Thap1 C A 8: 26,162,651 T139K probably damaging Het
Tle4 T A 19: 14,564,453 probably null Het
Tmem87a A T 2: 120,362,928 M502K possibly damaging Het
Tpcn2 A T 7: 145,256,785 V605E probably benign Het
Trgj1 C A 13: 19,210,359 probably benign Het
Tsc2 A T 17: 24,628,054 V179E probably damaging Het
Ubap2l T C 3: 90,009,241 T909A probably damaging Het
Ubl4b T G 3: 107,554,824 Q40P probably damaging Het
Vmn1r229 A G 17: 20,815,015 D174G probably damaging Het
Vmn2r50 A T 7: 10,046,037 Y472* probably null Het
Vmn2r74 T A 7: 85,952,735 D565V probably benign Het
Vmn2r74 T A 7: 85,957,652 probably null Het
Vmn2r82 T A 10: 79,396,543 V792E probably damaging Het
Zfp335 G A 2: 164,893,290 Q1179* probably null Het
Zmynd12 A C 4: 119,453,575 K327Q probably benign Het
Zwilch G A 9: 64,165,449 Q27* probably null Het
Other mutations in Nampt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02437:Nampt APN 12 32830216 missense probably damaging 1.00
IGL02512:Nampt APN 12 32830269 missense possibly damaging 0.72
IGL03095:Nampt APN 12 32842686 missense possibly damaging 0.85
Nacht UTSW 12 32833038 missense probably damaging 1.00
R0020:Nampt UTSW 12 32841013 missense probably damaging 0.97
R0417:Nampt UTSW 12 32833101 missense probably benign 0.01
R1087:Nampt UTSW 12 32833043 missense possibly damaging 0.88
R1781:Nampt UTSW 12 32833038 missense probably damaging 1.00
R2137:Nampt UTSW 12 32830310 missense probably benign
R2138:Nampt UTSW 12 32838422 missense possibly damaging 0.46
R3699:Nampt UTSW 12 32848759 splice site probably benign
R3970:Nampt UTSW 12 32833096 missense probably benign 0.02
R4434:Nampt UTSW 12 32838363 missense probably damaging 1.00
R4785:Nampt UTSW 12 32848714 missense possibly damaging 0.95
R5046:Nampt UTSW 12 32833038 missense probably damaging 1.00
R5055:Nampt UTSW 12 32833121 missense possibly damaging 0.94
R5427:Nampt UTSW 12 32834915 missense probably benign 0.00
R6063:Nampt UTSW 12 32848659 missense probably damaging 1.00
R6136:Nampt UTSW 12 32830302 missense probably benign 0.24
R7569:Nampt UTSW 12 32850434 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGTGAGAGATGACTTACCATTC -3'
(R):5'- GCTTCTCCAGAAATTAGTCACTGC -3'

Sequencing Primer
(F):5'- CCATTCAGTGAGAGATGACTTACC -3'
(R):5'- AGTCACTGCTAACTTACGGTAAG -3'
Posted On2019-05-13