Incidental Mutation 'R6995:Parp4'
ID544161
Institutional Source Beutler Lab
Gene Symbol Parp4
Ensembl Gene ENSMUSG00000054509
Gene Namepoly (ADP-ribose) polymerase family, member 4
Synonymsp193, Adprtl1, E230037B21Rik, PH5P, VAULT3, VPARP, C030027K23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R6995 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location56575619-56659794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 56613739 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 733 (Q733P)
Ref Sequence ENSEMBL: ENSMUSP00000124258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161553]
Predicted Effect probably damaging
Transcript: ENSMUST00000161553
AA Change: Q733P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124258
Gene: ENSMUSG00000054509
AA Change: Q733P

DomainStartEndE-ValueType
BRCT 3 84 4.32e-9 SMART
low complexity region 97 104 N/A INTRINSIC
SCOP:d1a26_1 252 352 2e-19 SMART
Pfam:PARP 371 559 1.8e-50 PFAM
VIT 600 728 1.5e-57 SMART
VWA 867 1030 6.08e-13 SMART
Blast:14_3_3 1149 1205 5e-10 BLAST
low complexity region 1255 1264 N/A INTRINSIC
low complexity region 1348 1362 N/A INTRINSIC
low complexity region 1371 1394 N/A INTRINSIC
internal_repeat_1 1395 1416 4.48e-6 PROSPERO
Pfam:Drf_FH1 1443 1542 3.3e-15 PFAM
low complexity region 1553 1587 N/A INTRINSIC
internal_repeat_2 1588 1608 2.45e-5 PROSPERO
low complexity region 1695 1708 N/A INTRINSIC
low complexity region 1739 1750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are helathy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A G 7: 40,994,725 Y606C probably benign Het
5430419D17Rik G T 7: 131,222,671 W165L probably damaging Het
5830411N06Rik G A 7: 140,261,601 D273N probably benign Het
Acad9 A G 3: 36,085,481 Y410C probably damaging Het
Acot6 C T 12: 84,109,375 P366S probably damaging Het
Anks1 G T 17: 28,054,299 G964V probably damaging Het
Apol7a A T 15: 77,389,976 probably benign Het
Arid3c G A 4: 41,725,087 A320V probably damaging Het
Bnip3l A T 14: 66,999,652 N50K probably benign Het
C130060K24Rik A T 6: 65,441,301 K151I probably damaging Het
C1qtnf4 C A 2: 90,889,953 A190D probably benign Het
Cdh1 G T 8: 106,660,913 V482L probably benign Het
Cdrt4 A C 11: 62,992,660 I63L probably benign Het
Cic A T 7: 25,271,311 T156S possibly damaging Het
Ckm A G 7: 19,420,231 N301S probably benign Het
Colgalt1 C T 8: 71,623,521 R539C probably damaging Het
Cop1 A G 1: 159,306,584 D132G probably damaging Het
Cpd G T 11: 76,785,055 N1257K probably benign Het
Cyp2c67 T C 19: 39,615,679 H411R probably damaging Het
Cyp2r1 A T 7: 114,553,081 F5I probably damaging Het
Dclk3 T A 9: 111,467,700 L104Q possibly damaging Het
Dnah7c A T 1: 46,455,813 Q67L probably benign Het
Dnm1l C A 16: 16,329,807 E365* probably null Het
Dst A T 1: 34,166,234 I502F probably damaging Het
Espl1 T C 15: 102,304,100 V547A possibly damaging Het
Fam26e A T 10: 34,096,193 M82K probably benign Het
Foxa1 C T 12: 57,542,478 A319T probably benign Het
Frem1 G T 4: 82,986,601 H859N probably damaging Het
Frem3 T A 8: 80,612,579 D500E probably damaging Het
Gm9774 T C 3: 92,429,008 probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grip1 A G 10: 119,986,470 D394G probably damaging Het
Gsap C A 5: 21,271,237 T589K possibly damaging Het
Gsg1l A G 7: 125,923,486 V190A probably damaging Het
Kcnmb1 A T 11: 33,970,131 T115S probably benign Het
Kirrel2 A C 7: 30,455,179 F169C probably damaging Het
L3mbtl1 C T 2: 162,961,448 T397M probably damaging Het
Lama1 G A 17: 67,753,825 C716Y Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Lrig1 T C 6: 94,611,629 D513G possibly damaging Het
Lrrk1 T C 7: 66,292,342 D716G probably damaging Het
Matn4 G A 2: 164,389,664 R582* probably null Het
Mdn1 A T 4: 32,733,374 R3133W probably benign Het
Mmp7 A G 9: 7,695,488 D122G probably damaging Het
Naaladl1 A G 19: 6,115,548 D744G possibly damaging Het
Nampt T G 12: 32,848,743 Y453D probably benign Het
Nlrp12 A G 7: 3,239,851 V677A probably benign Het
Ntng2 T C 2: 29,197,068 N414S probably damaging Het
Olfr1 A G 11: 73,395,584 V146A probably benign Het
Olfr1160 A C 2: 88,006,185 F189V probably benign Het
Olfr1284 A G 2: 111,379,363 D121G probably damaging Het
Olfr472 A G 7: 107,903,622 R302G probably benign Het
Pdcl3 G A 1: 38,995,336 V56I probably benign Het
Pepd A G 7: 35,021,719 Y256C probably damaging Het
Plg G T 17: 12,419,051 R788L probably benign Het
Plod1 A T 4: 147,916,218 probably benign Het
Ptprc A G 1: 138,088,744 V513A probably damaging Het
Pxdn T C 12: 29,995,371 I373T possibly damaging Het
Rbbp8 G A 18: 11,718,908 G262E probably damaging Het
Rfc2 T A 5: 134,594,250 Y240* probably null Het
Rps15 A G 10: 80,293,764 E71G possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr1 A C 7: 29,094,182 M1287R probably damaging Het
Serpina9 A G 12: 104,001,236 L300P probably damaging Het
Sh3rf2 G A 18: 42,101,541 A130T probably damaging Het
Slc12a8 G A 16: 33,534,893 W26* probably null Het
Snx18 A T 13: 113,594,729 H576Q probably damaging Het
Tagln3 G A 16: 45,722,958 T107I probably benign Het
Thap1 C A 8: 26,162,651 T139K probably damaging Het
Tle4 T A 19: 14,564,453 probably null Het
Tmem87a A T 2: 120,362,928 M502K possibly damaging Het
Tpcn2 A T 7: 145,256,785 V605E probably benign Het
Trgj1 C A 13: 19,210,359 probably benign Het
Tsc2 A T 17: 24,628,054 V179E probably damaging Het
Ubap2l T C 3: 90,009,241 T909A probably damaging Het
Ubl4b T G 3: 107,554,824 Q40P probably damaging Het
Vmn1r229 A G 17: 20,815,015 D174G probably damaging Het
Vmn2r50 A T 7: 10,046,037 Y472* probably null Het
Vmn2r74 T A 7: 85,952,735 D565V probably benign Het
Vmn2r74 T A 7: 85,957,652 probably null Het
Vmn2r82 T A 10: 79,396,543 V792E probably damaging Het
Zfp335 G A 2: 164,893,290 Q1179* probably null Het
Zmynd12 A C 4: 119,453,575 K327Q probably benign Het
Zwilch G A 9: 64,165,449 Q27* probably null Het
Other mutations in Parp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Parp4 APN 14 56616460 missense possibly damaging 0.82
IGL00571:Parp4 APN 14 56647353 missense unknown
IGL00737:Parp4 APN 14 56584163 missense probably damaging 0.99
IGL00793:Parp4 APN 14 56602877 missense possibly damaging 0.73
IGL01108:Parp4 APN 14 56607440 missense probably benign 0.01
IGL01131:Parp4 APN 14 56585760 splice site probably benign
IGL01485:Parp4 APN 14 56622204 missense possibly damaging 0.54
IGL01704:Parp4 APN 14 56602326 missense probably damaging 0.99
IGL01993:Parp4 APN 14 56610788 missense possibly damaging 0.82
IGL02125:Parp4 APN 14 56590502 missense probably benign 0.33
IGL02851:Parp4 APN 14 56648869 missense unknown
IGL02863:Parp4 APN 14 56648786 missense unknown
IGL03065:Parp4 APN 14 56637869 missense probably benign 0.09
IGL03117:Parp4 APN 14 56602856 missense probably benign 0.17
IGL03271:Parp4 APN 14 56585625 missense probably benign 0.10
IGL03309:Parp4 APN 14 56587808 missense probably benign 0.11
IGL03408:Parp4 APN 14 56602408 missense probably damaging 0.99
R0278:Parp4 UTSW 14 56607523 missense probably damaging 0.99
R0320:Parp4 UTSW 14 56588496 critical splice donor site probably null
R0445:Parp4 UTSW 14 56602748 splice site probably null
R0452:Parp4 UTSW 14 56648843 missense unknown
R0511:Parp4 UTSW 14 56635715 splice site probably benign
R0515:Parp4 UTSW 14 56613667 missense probably damaging 1.00
R0608:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R0800:Parp4 UTSW 14 56589951 missense probably benign 0.00
R0959:Parp4 UTSW 14 56648119 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1207:Parp4 UTSW 14 56647882 missense unknown
R1342:Parp4 UTSW 14 56590397 missense probably damaging 1.00
R1520:Parp4 UTSW 14 56598406 missense probably damaging 1.00
R1565:Parp4 UTSW 14 56589872 splice site probably benign
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1574:Parp4 UTSW 14 56602295 missense probably damaging 0.98
R1649:Parp4 UTSW 14 56590428 missense possibly damaging 0.95
R1666:Parp4 UTSW 14 56624163 missense possibly damaging 0.91
R1781:Parp4 UTSW 14 56627381 splice site probably null
R1799:Parp4 UTSW 14 56648132 missense unknown
R1823:Parp4 UTSW 14 56589872 splice site probably benign
R1859:Parp4 UTSW 14 56648915 missense unknown
R1919:Parp4 UTSW 14 56624017 missense probably damaging 1.00
R2000:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R2032:Parp4 UTSW 14 56629096 missense possibly damaging 0.71
R2034:Parp4 UTSW 14 56634263 missense probably damaging 1.00
R2177:Parp4 UTSW 14 56659289 missense unknown
R2291:Parp4 UTSW 14 56613817 missense probably damaging 1.00
R2865:Parp4 UTSW 14 56613724 missense probably damaging 0.98
R3012:Parp4 UTSW 14 56595416 critical splice donor site probably null
R3841:Parp4 UTSW 14 56587778 missense probably damaging 0.97
R3913:Parp4 UTSW 14 56620518 missense probably damaging 1.00
R4064:Parp4 UTSW 14 56624140 missense probably benign 0.06
R4201:Parp4 UTSW 14 56592391 missense possibly damaging 0.95
R4288:Parp4 UTSW 14 56607494 missense probably damaging 1.00
R4360:Parp4 UTSW 14 56629204 missense possibly damaging 0.89
R4506:Parp4 UTSW 14 56652304 missense unknown
R4577:Parp4 UTSW 14 56590410 missense probably benign 0.33
R4633:Parp4 UTSW 14 56647591 missense unknown
R4762:Parp4 UTSW 14 56610810 missense probably damaging 1.00
R4836:Parp4 UTSW 14 56585738 missense probably benign 0.00
R4974:Parp4 UTSW 14 56589898 missense possibly damaging 0.92
R5049:Parp4 UTSW 14 56635731 missense possibly damaging 0.81
R5479:Parp4 UTSW 14 56624095 missense probably benign 0.01
R5683:Parp4 UTSW 14 56647429 nonsense probably null
R5884:Parp4 UTSW 14 56614750 missense probably damaging 1.00
R5965:Parp4 UTSW 14 56624032 missense probably benign 0.11
R6001:Parp4 UTSW 14 56641283 missense probably benign 0.01
R6027:Parp4 UTSW 14 56629158 missense probably benign 0.28
R6230:Parp4 UTSW 14 56607533 missense probably damaging 1.00
R6242:Parp4 UTSW 14 56595399 nonsense probably null
R6355:Parp4 UTSW 14 56602300 missense possibly damaging 0.61
R6414:Parp4 UTSW 14 56627381 splice site probably null
R6418:Parp4 UTSW 14 56620651 critical splice donor site probably null
R6477:Parp4 UTSW 14 56647237 missense probably benign 0.00
R6542:Parp4 UTSW 14 56647882 missense unknown
R6759:Parp4 UTSW 14 56620490 missense probably benign 0.10
R7002:Parp4 UTSW 14 56602404 missense probably damaging 1.00
R7026:Parp4 UTSW 14 56620592 missense probably benign 0.01
R7062:Parp4 UTSW 14 56614759 missense possibly damaging 0.48
R7101:Parp4 UTSW 14 56589973 missense probably benign 0.02
R7124:Parp4 UTSW 14 56602799 missense probably benign 0.11
R7162:Parp4 UTSW 14 56648876 missense unknown
R7293:Parp4 UTSW 14 56647846 small deletion probably benign
R7297:Parp4 UTSW 14 56647681 missense not run
R7337:Parp4 UTSW 14 56602395 missense probably damaging 1.00
R7539:Parp4 UTSW 14 56635755 missense probably damaging 1.00
R7575:Parp4 UTSW 14 56637918 missense probably benign 0.28
R7808:Parp4 UTSW 14 56635748 missense possibly damaging 0.65
R7854:Parp4 UTSW 14 56659348 missense unknown
R8152:Parp4 UTSW 14 56647246 missense probably benign 0.00
RF020:Parp4 UTSW 14 56647349 missense unknown
Z1177:Parp4 UTSW 14 56592367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCCCCATCACACTAGTAATGG -3'
(R):5'- ATGTCAGGGACACCTCTGAC -3'

Sequencing Primer
(F):5'- CTTGAGAAGAACTTGACTGATTGTC -3'
(R):5'- CAGTGAGTGCTCTTAACCACTGAG -3'
Posted On2019-05-13