Incidental Mutation 'R6995:Espl1'
ID544164
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Nameextra spindle pole bodies 1, separase
SynonymsSSE, ESP1, PRCE, Cerp, PRCE, separase
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6995 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location102296266-102324357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102304100 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 547 (V547A)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064924
AA Change: V547A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: V547A

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000229050
AA Change: V547A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A G 7: 40,994,725 Y606C probably benign Het
5430419D17Rik G T 7: 131,222,671 W165L probably damaging Het
5830411N06Rik G A 7: 140,261,601 D273N probably benign Het
Acad9 A G 3: 36,085,481 Y410C probably damaging Het
Acot6 C T 12: 84,109,375 P366S probably damaging Het
Anks1 G T 17: 28,054,299 G964V probably damaging Het
Apol7a A T 15: 77,389,976 probably benign Het
Arid3c G A 4: 41,725,087 A320V probably damaging Het
Bnip3l A T 14: 66,999,652 N50K probably benign Het
C130060K24Rik A T 6: 65,441,301 K151I probably damaging Het
C1qtnf4 C A 2: 90,889,953 A190D probably benign Het
Cdh1 G T 8: 106,660,913 V482L probably benign Het
Cdrt4 A C 11: 62,992,660 I63L probably benign Het
Cic A T 7: 25,271,311 T156S possibly damaging Het
Ckm A G 7: 19,420,231 N301S probably benign Het
Colgalt1 C T 8: 71,623,521 R539C probably damaging Het
Cop1 A G 1: 159,306,584 D132G probably damaging Het
Cpd G T 11: 76,785,055 N1257K probably benign Het
Cyp2c67 T C 19: 39,615,679 H411R probably damaging Het
Cyp2r1 A T 7: 114,553,081 F5I probably damaging Het
Dclk3 T A 9: 111,467,700 L104Q possibly damaging Het
Dnah7c A T 1: 46,455,813 Q67L probably benign Het
Dnm1l C A 16: 16,329,807 E365* probably null Het
Dst A T 1: 34,166,234 I502F probably damaging Het
Fam26e A T 10: 34,096,193 M82K probably benign Het
Foxa1 C T 12: 57,542,478 A319T probably benign Het
Frem1 G T 4: 82,986,601 H859N probably damaging Het
Frem3 T A 8: 80,612,579 D500E probably damaging Het
Gm9774 T C 3: 92,429,008 probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grip1 A G 10: 119,986,470 D394G probably damaging Het
Gsap C A 5: 21,271,237 T589K possibly damaging Het
Gsg1l A G 7: 125,923,486 V190A probably damaging Het
Kcnmb1 A T 11: 33,970,131 T115S probably benign Het
Kirrel2 A C 7: 30,455,179 F169C probably damaging Het
L3mbtl1 C T 2: 162,961,448 T397M probably damaging Het
Lama1 G A 17: 67,753,825 C716Y Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Lrig1 T C 6: 94,611,629 D513G possibly damaging Het
Lrrk1 T C 7: 66,292,342 D716G probably damaging Het
Matn4 G A 2: 164,389,664 R582* probably null Het
Mdn1 A T 4: 32,733,374 R3133W probably benign Het
Mmp7 A G 9: 7,695,488 D122G probably damaging Het
Naaladl1 A G 19: 6,115,548 D744G possibly damaging Het
Nampt T G 12: 32,848,743 Y453D probably benign Het
Nlrp12 A G 7: 3,239,851 V677A probably benign Het
Ntng2 T C 2: 29,197,068 N414S probably damaging Het
Olfr1 A G 11: 73,395,584 V146A probably benign Het
Olfr1160 A C 2: 88,006,185 F189V probably benign Het
Olfr1284 A G 2: 111,379,363 D121G probably damaging Het
Olfr472 A G 7: 107,903,622 R302G probably benign Het
Parp4 A C 14: 56,613,739 Q733P probably damaging Het
Pdcl3 G A 1: 38,995,336 V56I probably benign Het
Pepd A G 7: 35,021,719 Y256C probably damaging Het
Plg G T 17: 12,419,051 R788L probably benign Het
Plod1 A T 4: 147,916,218 probably benign Het
Ptprc A G 1: 138,088,744 V513A probably damaging Het
Pxdn T C 12: 29,995,371 I373T possibly damaging Het
Rbbp8 G A 18: 11,718,908 G262E probably damaging Het
Rfc2 T A 5: 134,594,250 Y240* probably null Het
Rps15 A G 10: 80,293,764 E71G possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr1 A C 7: 29,094,182 M1287R probably damaging Het
Serpina9 A G 12: 104,001,236 L300P probably damaging Het
Sh3rf2 G A 18: 42,101,541 A130T probably damaging Het
Slc12a8 G A 16: 33,534,893 W26* probably null Het
Snx18 A T 13: 113,594,729 H576Q probably damaging Het
Tagln3 G A 16: 45,722,958 T107I probably benign Het
Thap1 C A 8: 26,162,651 T139K probably damaging Het
Tle4 T A 19: 14,564,453 probably null Het
Tmem87a A T 2: 120,362,928 M502K possibly damaging Het
Tpcn2 A T 7: 145,256,785 V605E probably benign Het
Trgj1 C A 13: 19,210,359 probably benign Het
Tsc2 A T 17: 24,628,054 V179E probably damaging Het
Ubap2l T C 3: 90,009,241 T909A probably damaging Het
Ubl4b T G 3: 107,554,824 Q40P probably damaging Het
Vmn1r229 A G 17: 20,815,015 D174G probably damaging Het
Vmn2r50 A T 7: 10,046,037 Y472* probably null Het
Vmn2r74 T A 7: 85,952,735 D565V probably benign Het
Vmn2r74 T A 7: 85,957,652 probably null Het
Vmn2r82 T A 10: 79,396,543 V792E probably damaging Het
Zfp335 G A 2: 164,893,290 Q1179* probably null Het
Zmynd12 A C 4: 119,453,575 K327Q probably benign Het
Zwilch G A 9: 64,165,449 Q27* probably null Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102299813 missense probably damaging 1.00
IGL00839:Espl1 APN 15 102320547 unclassified probably benign
IGL00919:Espl1 APN 15 102298629 missense probably benign 0.03
IGL01125:Espl1 APN 15 102322938 missense probably damaging 1.00
IGL01366:Espl1 APN 15 102319836 missense probably benign 0.00
IGL01488:Espl1 APN 15 102298739 missense probably benign
IGL01554:Espl1 APN 15 102313225 missense probably damaging 1.00
IGL01810:Espl1 APN 15 102298205 missense probably benign
IGL01959:Espl1 APN 15 102305662 splice site probably benign
IGL02267:Espl1 APN 15 102315664 missense probably benign 0.01
IGL02452:Espl1 APN 15 102299839 missense probably damaging 1.00
IGL02469:Espl1 APN 15 102314025 missense probably damaging 1.00
IGL02500:Espl1 APN 15 102315800 missense probably benign
IGL02630:Espl1 APN 15 102296818 missense probably benign 0.11
IGL02687:Espl1 APN 15 102313178 splice site probably benign
IGL02868:Espl1 APN 15 102313990 nonsense probably null
IGL02926:Espl1 APN 15 102299855 missense probably damaging 0.99
R0019:Espl1 UTSW 15 102306319 missense probably null 0.01
R0129:Espl1 UTSW 15 102316648 missense probably benign 0.00
R0184:Espl1 UTSW 15 102299216 missense probably benign 0.01
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0267:Espl1 UTSW 15 102313017 missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102303986 nonsense probably null
R0587:Espl1 UTSW 15 102303947 splice site probably benign
R0726:Espl1 UTSW 15 102322598 missense probably benign
R1186:Espl1 UTSW 15 102304039 missense probably benign 0.05
R1282:Espl1 UTSW 15 102315391 missense probably benign 0.00
R1428:Espl1 UTSW 15 102305685 missense probably benign 0.06
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1473:Espl1 UTSW 15 102320443 missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102298367 missense probably damaging 0.98
R1639:Espl1 UTSW 15 102320714 missense probably damaging 1.00
R1725:Espl1 UTSW 15 102313221 missense probably benign 0.08
R1748:Espl1 UTSW 15 102298529 missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102299013 missense probably benign
R1938:Espl1 UTSW 15 102305042 missense probably benign 0.00
R1954:Espl1 UTSW 15 102298388 missense probably damaging 1.00
R2009:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2014:Espl1 UTSW 15 102322714 nonsense probably null
R2067:Espl1 UTSW 15 102299090 missense probably damaging 0.96
R2084:Espl1 UTSW 15 102296851 critical splice donor site probably null
R2164:Espl1 UTSW 15 102319588 missense probably damaging 1.00
R2204:Espl1 UTSW 15 102305905 missense probably damaging 1.00
R2220:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2237:Espl1 UTSW 15 102315569 missense probably damaging 0.98
R2314:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3107:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3108:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3114:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3616:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3733:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3958:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3959:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3960:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4062:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4063:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4064:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4165:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4166:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4349:Espl1 UTSW 15 102319604 missense probably benign 0.26
R4373:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4376:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4377:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4516:Espl1 UTSW 15 102323236 missense probably benign 0.00
R4595:Espl1 UTSW 15 102298724 missense probably benign 0.01
R4884:Espl1 UTSW 15 102324070 missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102322323 critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102315241 missense probably damaging 0.98
R4931:Espl1 UTSW 15 102305730 missense probably benign 0.02
R4936:Espl1 UTSW 15 102304937 missense probably damaging 1.00
R5000:Espl1 UTSW 15 102298551 missense probably damaging 1.00
R5220:Espl1 UTSW 15 102298577 missense probably benign 0.03
R5329:Espl1 UTSW 15 102312518 missense probably damaging 0.97
R5501:Espl1 UTSW 15 102317130 missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102324030 missense probably damaging 1.00
R5848:Espl1 UTSW 15 102322576 missense probably benign 0.03
R5906:Espl1 UTSW 15 102296851 critical splice donor site probably null
R5978:Espl1 UTSW 15 102315774 missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102299888 missense probably damaging 0.99
R6313:Espl1 UTSW 15 102315812 missense probably benign 0.00
R6414:Espl1 UTSW 15 102315560 missense probably damaging 0.96
R6484:Espl1 UTSW 15 102323500 missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102299225 missense probably benign
R6928:Espl1 UTSW 15 102298907 missense probably benign 0.28
R7053:Espl1 UTSW 15 102316893 critical splice donor site probably null
R7062:Espl1 UTSW 15 102298896 missense probably benign 0.00
R7135:Espl1 UTSW 15 102319524 nonsense probably null
R7154:Espl1 UTSW 15 102324049 missense probably damaging 1.00
R7164:Espl1 UTSW 15 102313203 missense probably damaging 1.00
R7522:Espl1 UTSW 15 102305051 missense probably damaging 1.00
R7848:Espl1 UTSW 15 102316526 missense probably damaging 1.00
R7894:Espl1 UTSW 15 102304025 missense probably damaging 1.00
R8275:Espl1 UTSW 15 102302753 splice site probably benign
R8752:Espl1 UTSW 15 102306324 missense probably damaging 1.00
X0062:Espl1 UTSW 15 102298397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGGCTTCATGTTCCAG -3'
(R):5'- CACTGTGTGCCTTATACCCAG -3'

Sequencing Primer
(F):5'- AGTGGCTTCATGTTCCAGCTTTC -3'
(R):5'- GCCTTTAATTCCAGCACTAGGAAGG -3'
Posted On2019-05-13