Mutagenetix > Incidental Mutation

Incidental Mutation 'R6995:Espl1'

544164

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6995 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102304100 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 547 (V547A)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064924
AA Change: V547A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: V547A

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000229050
AA Change: V547A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	G	7: 40,994,725	Y606C	probably benign	Het
5430419D17Rik	G	T	7: 131,222,671	W165L	probably damaging	Het
5830411N06Rik	G	A	7: 140,261,601	D273N	probably benign	Het
Acad9	A	G	3: 36,085,481	Y410C	probably damaging	Het
Acot6	C	T	12: 84,109,375	P366S	probably damaging	Het
Anks1	G	T	17: 28,054,299	G964V	probably damaging	Het
Apol7a	A	T	15: 77,389,976		probably benign	Het
Arid3c	G	A	4: 41,725,087	A320V	probably damaging	Het
Bnip3l	A	T	14: 66,999,652	N50K	probably benign	Het
C130060K24Rik	A	T	6: 65,441,301	K151I	probably damaging	Het
C1qtnf4	C	A	2: 90,889,953	A190D	probably benign	Het
Cdh1	G	T	8: 106,660,913	V482L	probably benign	Het
Cdrt4	A	C	11: 62,992,660	I63L	probably benign	Het
Cic	A	T	7: 25,271,311	T156S	possibly damaging	Het
Ckm	A	G	7: 19,420,231	N301S	probably benign	Het
Colgalt1	C	T	8: 71,623,521	R539C	probably damaging	Het
Cop1	A	G	1: 159,306,584	D132G	probably damaging	Het
Cpd	G	T	11: 76,785,055	N1257K	probably benign	Het
Cyp2c67	T	C	19: 39,615,679	H411R	probably damaging	Het
Cyp2r1	A	T	7: 114,553,081	F5I	probably damaging	Het
Dclk3	T	A	9: 111,467,700	L104Q	possibly damaging	Het
Dnah7c	A	T	1: 46,455,813	Q67L	probably benign	Het
Dnm1l	C	A	16: 16,329,807	E365*	probably null	Het
Dst	A	T	1: 34,166,234	I502F	probably damaging	Het
Fam26e	A	T	10: 34,096,193	M82K	probably benign	Het
Foxa1	C	T	12: 57,542,478	A319T	probably benign	Het
Frem1	G	T	4: 82,986,601	H859N	probably damaging	Het
Frem3	T	A	8: 80,612,579	D500E	probably damaging	Het
Gm9774	T	C	3: 92,429,008		probably benign	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Grip1	A	G	10: 119,986,470	D394G	probably damaging	Het
Gsap	C	A	5: 21,271,237	T589K	possibly damaging	Het
Gsg1l	A	G	7: 125,923,486	V190A	probably damaging	Het
Kcnmb1	A	T	11: 33,970,131	T115S	probably benign	Het
Kirrel2	A	C	7: 30,455,179	F169C	probably damaging	Het
L3mbtl1	C	T	2: 162,961,448	T397M	probably damaging	Het
Lama1	G	A	17: 67,753,825	C716Y		Het
Lamc2	G	A	1: 153,136,762	T722M	probably benign	Het
Lrig1	T	C	6: 94,611,629	D513G	possibly damaging	Het
Lrrk1	T	C	7: 66,292,342	D716G	probably damaging	Het
Matn4	G	A	2: 164,389,664	R582*	probably null	Het
Mdn1	A	T	4: 32,733,374	R3133W	probably benign	Het
Mmp7	A	G	9: 7,695,488	D122G	probably damaging	Het
Naaladl1	A	G	19: 6,115,548	D744G	possibly damaging	Het
Nampt	T	G	12: 32,848,743	Y453D	probably benign	Het
Nlrp12	A	G	7: 3,239,851	V677A	probably benign	Het
Ntng2	T	C	2: 29,197,068	N414S	probably damaging	Het
Olfr1	A	G	11: 73,395,584	V146A	probably benign	Het
Olfr1160	A	C	2: 88,006,185	F189V	probably benign	Het
Olfr1284	A	G	2: 111,379,363	D121G	probably damaging	Het
Olfr472	A	G	7: 107,903,622	R302G	probably benign	Het
Parp4	A	C	14: 56,613,739	Q733P	probably damaging	Het
Pdcl3	G	A	1: 38,995,336	V56I	probably benign	Het
Pepd	A	G	7: 35,021,719	Y256C	probably damaging	Het
Plg	G	T	17: 12,419,051	R788L	probably benign	Het
Plod1	A	T	4: 147,916,218		probably benign	Het
Ptprc	A	G	1: 138,088,744	V513A	probably damaging	Het
Pxdn	T	C	12: 29,995,371	I373T	possibly damaging	Het
Rbbp8	G	A	18: 11,718,908	G262E	probably damaging	Het
Rfc2	T	A	5: 134,594,250	Y240*	probably null	Het
Rps15	A	G	10: 80,293,764	E71G	possibly damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Ryr1	A	C	7: 29,094,182	M1287R	probably damaging	Het
Serpina9	A	G	12: 104,001,236	L300P	probably damaging	Het
Sh3rf2	G	A	18: 42,101,541	A130T	probably damaging	Het
Slc12a8	G	A	16: 33,534,893	W26*	probably null	Het
Snx18	A	T	13: 113,594,729	H576Q	probably damaging	Het
Tagln3	G	A	16: 45,722,958	T107I	probably benign	Het
Thap1	C	A	8: 26,162,651	T139K	probably damaging	Het
Tle4	T	A	19: 14,564,453		probably null	Het
Tmem87a	A	T	2: 120,362,928	M502K	possibly damaging	Het
Tpcn2	A	T	7: 145,256,785	V605E	probably benign	Het
Trgj1	C	A	13: 19,210,359		probably benign	Het
Tsc2	A	T	17: 24,628,054	V179E	probably damaging	Het
Ubap2l	T	C	3: 90,009,241	T909A	probably damaging	Het
Ubl4b	T	G	3: 107,554,824	Q40P	probably damaging	Het
Vmn1r229	A	G	17: 20,815,015	D174G	probably damaging	Het
Vmn2r50	A	T	7: 10,046,037	Y472*	probably null	Het
Vmn2r74	T	A	7: 85,952,735	D565V	probably benign	Het
Vmn2r74	T	A	7: 85,957,652		probably null	Het
Vmn2r82	T	A	10: 79,396,543	V792E	probably damaging	Het
Zfp335	G	A	2: 164,893,290	Q1179*	probably null	Het
Zmynd12	A	C	4: 119,453,575	K327Q	probably benign	Het
Zwilch	G	A	9: 64,165,449	Q27*	probably null	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGTGGCTTCATGTTCCAG -3'
(R):5'- CACTGTGTGCCTTATACCCAG -3'

Sequencing Primer
(F):5'- AGTGGCTTCATGTTCCAGCTTTC -3'
(R):5'- GCCTTTAATTCCAGCACTAGGAAGG -3'

Posted On

2019-05-13