Incidental Mutation 'R6996:Flg2'
ID 544188
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
MMRRC Submission 045102-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R6996 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 93104585-93128698 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 93109977 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 668 (E668D)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000098884
AA Change: E668D
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: E668D

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 G A 8: 25,296,517 (GRCm39) S310L probably damaging Het
Adamts16 C T 13: 70,946,157 (GRCm39) probably null Het
Arrb1 C A 7: 99,240,569 (GRCm39) D194E probably benign Het
Atp1a3 T C 7: 24,697,051 (GRCm39) D217G probably damaging Het
Bcar3 A G 3: 122,302,033 (GRCm39) I123V possibly damaging Het
Bdp1 G A 13: 100,180,321 (GRCm39) L1833F probably damaging Het
Cdc14a T C 3: 116,122,355 (GRCm39) Y155C probably damaging Het
Cdo1 C A 18: 46,853,380 (GRCm39) R126M possibly damaging Het
Cfap99 G T 5: 34,484,604 (GRCm39) R627L probably damaging Het
Efr3a T A 15: 65,720,030 (GRCm39) L369* probably null Het
Erich6 A C 3: 58,543,516 (GRCm39) F185V probably damaging Het
Fam186a T C 15: 99,853,374 (GRCm39) D122G unknown Het
Fank1 A G 7: 133,478,627 (GRCm39) I230M possibly damaging Het
Gabrr1 T C 4: 33,158,157 (GRCm39) L260P probably damaging Het
Gfm2 G A 13: 97,285,868 (GRCm39) R119K probably damaging Het
Gm14226 A G 2: 154,866,357 (GRCm39) T105A probably benign Het
Gm14496 A G 2: 181,637,997 (GRCm39) N357S probably damaging Het
Gm5916 G A 9: 36,039,935 (GRCm39) L18F probably benign Het
Golm1 A T 13: 59,790,058 (GRCm39) N247K probably benign Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Greb1 C T 12: 16,773,355 (GRCm39) A240T probably benign Het
Gtf3c6 T C 10: 40,125,774 (GRCm39) M148V probably benign Het
Guca1a T C 17: 47,706,102 (GRCm39) S126G probably benign Het
Hacl1 A T 14: 31,337,380 (GRCm39) I393N possibly damaging Het
Hddc3 A G 7: 79,993,498 (GRCm39) D68G possibly damaging Het
Hsfy2 T C 1: 56,675,569 (GRCm39) T323A possibly damaging Het
Kcng2 T C 18: 80,366,358 (GRCm39) probably benign Het
Kdm2a G T 19: 4,395,669 (GRCm39) P321T probably benign Het
Krt31 A G 11: 99,938,558 (GRCm39) V345A probably benign Het
Lrrc37 A T 11: 103,509,583 (GRCm39) L795* probably null Het
Mettl1 T C 10: 126,880,887 (GRCm39) S193P probably benign Het
Mme G A 3: 63,253,523 (GRCm39) D456N possibly damaging Het
Mmrn1 A G 6: 60,954,367 (GRCm39) T883A probably benign Het
Mphosph10 C G 7: 64,038,669 (GRCm39) E293Q probably benign Het
Muc16 C A 9: 18,557,193 (GRCm39) K3033N unknown Het
Myo16 C T 8: 10,619,496 (GRCm39) T1349M probably damaging Het
Myo5c T C 9: 75,157,746 (GRCm39) I233T probably benign Het
Or4p4b-ps1 A G 2: 88,454,189 (GRCm39) T181A unknown Het
Or52a33 T G 7: 103,289,065 (GRCm39) N94T probably benign Het
Or52ac1 A T 7: 104,246,018 (GRCm39) F123L probably benign Het
Or5b111 A T 19: 13,291,036 (GRCm39) S204R probably benign Het
Or5h22 A G 16: 58,894,555 (GRCm39) M296T probably benign Het
Or6c2 T A 10: 129,362,732 (GRCm39) V212E probably damaging Het
Or7c70 C A 10: 78,683,351 (GRCm39) V133L probably benign Het
Oxct2b A G 4: 123,011,480 (GRCm39) I467V probably benign Het
Parp1 A T 1: 180,414,936 (GRCm39) N425Y possibly damaging Het
Pcdhgc3 T A 18: 37,939,656 (GRCm39) V19D possibly damaging Het
Pfkl T A 10: 77,833,423 (GRCm39) I260F probably damaging Het
Pkd1l1 C T 11: 8,799,046 (GRCm39) G1789R probably damaging Het
Pla1a G A 16: 38,217,830 (GRCm39) A386V probably benign Het
Pml A G 9: 58,142,169 (GRCm39) L221P probably damaging Het
Rcn2 C T 9: 55,964,845 (GRCm39) Q268* probably null Het
Reps1 T A 10: 17,969,603 (GRCm39) D235E probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,118 (GRCm39) probably benign Het
Sap30bp A G 11: 115,824,314 (GRCm39) probably benign Het
Scn1a A T 2: 66,118,075 (GRCm39) S1433T probably damaging Het
Sde2 T C 1: 180,678,754 (GRCm39) V6A probably benign Het
Sdk1 C A 5: 142,197,769 (GRCm39) R2141S probably benign Het
Setd2 T C 9: 110,379,640 (GRCm39) S1152P probably damaging Het
Slc26a2 C T 18: 61,334,926 (GRCm39) V176I probably damaging Het
Snx7 A G 3: 117,640,281 (GRCm39) I76T possibly damaging Het
Specc1l C A 10: 75,082,113 (GRCm39) A520D probably benign Het
Spop A G 11: 95,362,136 (GRCm39) T56A possibly damaging Het
Syne2 T A 12: 76,074,786 (GRCm39) D4576E probably damaging Het
Tas2r134 A C 2: 51,517,601 (GRCm39) M27L probably benign Het
Tecta A C 9: 42,278,082 (GRCm39) I1142S probably benign Het
Timm44 T C 8: 4,316,611 (GRCm39) D311G possibly damaging Het
Tmem123 C G 9: 7,791,071 (GRCm39) T124R possibly damaging Het
Tmem184b A T 15: 79,246,959 (GRCm39) L370Q probably benign Het
Trim25 T A 11: 88,890,329 (GRCm39) N5K probably benign Het
Vmn2r93 A G 17: 18,524,903 (GRCm39) Y187C probably damaging Het
Vpreb1a A G 16: 16,686,678 (GRCm39) Y71H probably damaging Het
Vpreb1b T C 16: 17,798,441 (GRCm39) S5P probably benign Het
Xpo7 A T 14: 70,906,888 (GRCm39) C939S probably benign Het
Zfp78 C A 7: 6,381,764 (GRCm39) S271R probably benign Het
Zic5 A T 14: 122,702,080 (GRCm39) M217K probably benign Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93,109,416 (GRCm39) nonsense probably null
IGL00092:Flg2 APN 3 93,127,162 (GRCm39) missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93,110,585 (GRCm39) missense unknown
IGL01077:Flg2 APN 3 93,127,513 (GRCm39) missense unknown
IGL01093:Flg2 APN 3 93,109,678 (GRCm39) missense unknown
IGL01120:Flg2 APN 3 93,108,475 (GRCm39) missense probably damaging 0.99
IGL01473:Flg2 APN 3 93,110,327 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,122,777 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,120,773 (GRCm39) missense unknown
IGL01686:Flg2 APN 3 93,109,591 (GRCm39) missense unknown
IGL02207:Flg2 APN 3 93,127,435 (GRCm39) missense unknown
IGL02294:Flg2 APN 3 93,111,053 (GRCm39) missense unknown
IGL02418:Flg2 APN 3 93,108,361 (GRCm39) missense probably benign 0.26
IGL02581:Flg2 APN 3 93,127,199 (GRCm39) missense unknown
IGL02719:Flg2 APN 3 93,127,438 (GRCm39) nonsense probably null
IGL02795:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02893:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02958:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03060:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03088:Flg2 APN 3 93,110,498 (GRCm39) missense unknown
IGL03165:Flg2 APN 3 93,121,918 (GRCm39) missense unknown
IGL03342:Flg2 APN 3 93,108,542 (GRCm39) missense probably damaging 1.00
IGL03352:Flg2 APN 3 93,109,801 (GRCm39) missense unknown
IGL02796:Flg2 UTSW 3 93,110,920 (GRCm39) missense unknown
IGL02837:Flg2 UTSW 3 93,109,044 (GRCm39) missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93,111,088 (GRCm39) missense unknown
R0087:Flg2 UTSW 3 93,109,738 (GRCm39) missense unknown
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0315:Flg2 UTSW 3 93,122,029 (GRCm39) missense unknown
R0390:Flg2 UTSW 3 93,107,662 (GRCm39) splice site probably benign
R0462:Flg2 UTSW 3 93,108,744 (GRCm39) missense probably benign 0.18
R0553:Flg2 UTSW 3 93,110,891 (GRCm39) missense unknown
R0828:Flg2 UTSW 3 93,110,639 (GRCm39) missense unknown
R1006:Flg2 UTSW 3 93,108,514 (GRCm39) missense probably benign 0.41
R1444:Flg2 UTSW 3 93,109,620 (GRCm39) missense unknown
R1497:Flg2 UTSW 3 93,127,076 (GRCm39) missense unknown
R1518:Flg2 UTSW 3 93,110,445 (GRCm39) missense unknown
R1737:Flg2 UTSW 3 93,110,928 (GRCm39) missense unknown
R1780:Flg2 UTSW 3 93,110,306 (GRCm39) missense unknown
R1797:Flg2 UTSW 3 93,108,283 (GRCm39) missense probably damaging 1.00
R2065:Flg2 UTSW 3 93,109,538 (GRCm39) missense unknown
R2168:Flg2 UTSW 3 93,109,244 (GRCm39) missense probably damaging 1.00
R2220:Flg2 UTSW 3 93,109,492 (GRCm39) missense unknown
R2292:Flg2 UTSW 3 93,127,984 (GRCm39) missense unknown
R2327:Flg2 UTSW 3 93,110,913 (GRCm39) nonsense probably null
R2512:Flg2 UTSW 3 93,109,082 (GRCm39) missense probably damaging 1.00
R3177:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3277:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3522:Flg2 UTSW 3 93,127,334 (GRCm39) missense unknown
R3779:Flg2 UTSW 3 93,109,730 (GRCm39) missense unknown
R3926:Flg2 UTSW 3 93,110,522 (GRCm39) missense unknown
R4082:Flg2 UTSW 3 93,110,828 (GRCm39) missense unknown
R4407:Flg2 UTSW 3 93,122,176 (GRCm39) missense unknown
R5152:Flg2 UTSW 3 93,122,284 (GRCm39) missense unknown
R5253:Flg2 UTSW 3 93,108,119 (GRCm39) missense probably damaging 1.00
R5290:Flg2 UTSW 3 93,127,873 (GRCm39) missense unknown
R5464:Flg2 UTSW 3 93,109,277 (GRCm39) missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93,127,753 (GRCm39) missense unknown
R5622:Flg2 UTSW 3 93,109,871 (GRCm39) missense unknown
R5788:Flg2 UTSW 3 93,108,296 (GRCm39) missense probably benign 0.41
R5792:Flg2 UTSW 3 93,110,804 (GRCm39) missense unknown
R5831:Flg2 UTSW 3 93,107,541 (GRCm39) missense probably damaging 1.00
R5877:Flg2 UTSW 3 93,110,756 (GRCm39) missense unknown
R6041:Flg2 UTSW 3 93,127,668 (GRCm39) missense probably benign 0.01
R6189:Flg2 UTSW 3 93,127,381 (GRCm39) missense unknown
R6214:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93,108,579 (GRCm39) missense probably benign 0.36
R6288:Flg2 UTSW 3 93,111,092 (GRCm39) missense unknown
R6413:Flg2 UTSW 3 93,127,683 (GRCm39) missense unknown
R6457:Flg2 UTSW 3 93,127,789 (GRCm39) missense unknown
R6468:Flg2 UTSW 3 93,121,728 (GRCm39) missense unknown
R6667:Flg2 UTSW 3 93,109,068 (GRCm39) missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93,108,642 (GRCm39) nonsense probably null
R6996:Flg2 UTSW 3 93,110,256 (GRCm39) missense unknown
R7100:Flg2 UTSW 3 93,111,018 (GRCm39) missense unknown
R7133:Flg2 UTSW 3 93,127,069 (GRCm39) missense unknown
R7180:Flg2 UTSW 3 93,110,140 (GRCm39) missense unknown
R7325:Flg2 UTSW 3 93,110,679 (GRCm39) missense unknown
R7349:Flg2 UTSW 3 93,127,513 (GRCm39) missense unknown
R7531:Flg2 UTSW 3 93,108,177 (GRCm39) missense probably damaging 0.99
R7571:Flg2 UTSW 3 93,127,303 (GRCm39) nonsense probably null
R7684:Flg2 UTSW 3 93,126,956 (GRCm39) missense unknown
R7810:Flg2 UTSW 3 93,107,548 (GRCm39) missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93,128,054 (GRCm39) missense unknown
R8031:Flg2 UTSW 3 93,127,521 (GRCm39) missense unknown
R8078:Flg2 UTSW 3 93,107,582 (GRCm39) missense probably damaging 1.00
R8142:Flg2 UTSW 3 93,122,782 (GRCm39) nonsense probably null
R8156:Flg2 UTSW 3 93,127,390 (GRCm39) missense unknown
R8172:Flg2 UTSW 3 93,108,468 (GRCm39) missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93,110,074 (GRCm39) missense unknown
R8262:Flg2 UTSW 3 93,127,517 (GRCm39) missense unknown
R8269:Flg2 UTSW 3 93,109,187 (GRCm39) missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93,110,069 (GRCm39) missense unknown
R8444:Flg2 UTSW 3 93,107,585 (GRCm39) missense probably damaging 0.97
R8670:Flg2 UTSW 3 93,108,791 (GRCm39) missense probably damaging 0.97
R8755:Flg2 UTSW 3 93,108,120 (GRCm39) missense probably damaging 1.00
R9039:Flg2 UTSW 3 93,110,899 (GRCm39) missense unknown
R9116:Flg2 UTSW 3 93,109,591 (GRCm39) missense unknown
R9214:Flg2 UTSW 3 93,110,884 (GRCm39) missense unknown
R9231:Flg2 UTSW 3 93,109,508 (GRCm39) missense unknown
R9553:Flg2 UTSW 3 93,121,901 (GRCm39) missense unknown
R9607:Flg2 UTSW 3 93,108,719 (GRCm39) missense probably damaging 0.98
R9735:Flg2 UTSW 3 93,127,669 (GRCm39) missense unknown
R9752:Flg2 UTSW 3 93,108,467 (GRCm39) missense probably damaging 0.98
Z1177:Flg2 UTSW 3 93,110,045 (GRCm39) missense unknown
Z1177:Flg2 UTSW 3 93,109,727 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCGAGTTCTGGGCACTCATC -3'
(R):5'- CCATAGCCAGATTCCTGACC -3'

Sequencing Primer
(F):5'- TGGGCACTCATCTAGCTCTGG -3'
(R):5'- TAGCCAGATTCCTGACCTGAGC -3'
Posted On 2019-05-13