Mutagenetix > Incidental Mutation

Incidental Mutation 'R6996:Muc16'

544211

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

045102-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.183) question?

Stock #

R6996 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 18645897 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 3033 (K3033N)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000208663]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000208663
AA Change: K3033N

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam5	G	A	8: 24,806,501	S310L	probably damaging	Het
Adamts16	C	T	13: 70,798,038		probably null	Het
Arrb1	C	A	7: 99,591,362	D194E	probably benign	Het
Atp1a3	T	C	7: 24,997,626	D217G	probably damaging	Het
Bcar3	A	G	3: 122,508,384	I123V	possibly damaging	Het
Bdp1	G	A	13: 100,043,813	L1833F	probably damaging	Het
Cdc14a	T	C	3: 116,328,706	Y155C	probably damaging	Het
Cdo1	C	A	18: 46,720,313	R126M	possibly damaging	Het
Cfap99	G	T	5: 34,327,260	R627L	probably damaging	Het
Efr3a	T	A	15: 65,848,181	L369*	probably null	Het
Erich6	A	C	3: 58,636,095	F185V	probably damaging	Het
Fam186a	T	C	15: 99,955,493	D122G	unknown	Het
Fank1	A	G	7: 133,876,898	I230M	possibly damaging	Het
Flg2	A	T	3: 93,202,670	E668D	unknown	Het
Flg2	A	C	3: 93,202,949	R761S	unknown	Het
Gabrr1	T	C	4: 33,158,157	L260P	probably damaging	Het
Gfm2	G	A	13: 97,149,360	R119K	probably damaging	Het
Gm14226	A	G	2: 155,024,437	T105A	probably benign	Het
Gm14496	A	G	2: 181,996,204	N357S	probably damaging	Het
Gm5916	G	A	9: 36,128,639	L18F	probably benign	Het
Gm884	A	T	11: 103,618,757	L795*	probably null	Het
Golm1	A	T	13: 59,642,244	N247K	probably benign	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Greb1	C	T	12: 16,723,354	A240T	probably benign	Het
Gtf3c6	T	C	10: 40,249,778	M148V	probably benign	Het
Guca1a	T	C	17: 47,395,177	S126G	probably benign	Het
Hacl1	A	T	14: 31,615,423	I393N	possibly damaging	Het
Hddc3	A	G	7: 80,343,750	D68G	possibly damaging	Het
Hsfy2	T	C	1: 56,636,410	T323A	possibly damaging	Het
Kcng2	T	C	18: 80,323,143		probably benign	Het
Kdm2a	G	T	19: 4,345,641	P321T	probably benign	Het
Krt31	A	G	11: 100,047,732	V345A	probably benign	Het
Mettl1	T	C	10: 127,045,018	S193P	probably benign	Het
Mme	G	A	3: 63,346,102	D456N	possibly damaging	Het
Mmrn1	A	G	6: 60,977,383	T883A	probably benign	Het
Mphosph10	C	G	7: 64,388,921	E293Q	probably benign	Het
Myo16	C	T	8: 10,569,496	T1349M	probably damaging	Het
Myo5c	T	C	9: 75,250,464	I233T	probably benign	Het
Olfr1356	C	A	10: 78,847,517	V133L	probably benign	Het
Olfr1465	A	T	19: 13,313,672	S204R	probably benign	Het
Olfr190	A	G	16: 59,074,192	M296T	probably benign	Het
Olfr475-ps1	A	G	2: 88,623,845	T181A	unknown	Het
Olfr622	T	G	7: 103,639,858	N94T	probably benign	Het
Olfr655	A	T	7: 104,596,811	F123L	probably benign	Het
Olfr791	T	A	10: 129,526,863	V212E	probably damaging	Het
Oxct2b	A	G	4: 123,117,687	I467V	probably benign	Het
Parp1	A	T	1: 180,587,371	N425Y	possibly damaging	Het
Pcdhgc3	T	A	18: 37,806,603	V19D	possibly damaging	Het
Pfkl	T	A	10: 77,997,589	I260F	probably damaging	Het
Pkd1l1	C	T	11: 8,849,046	G1789R	probably damaging	Het
Pla1a	G	A	16: 38,397,468	A386V	probably benign	Het
Pml	A	G	9: 58,234,886	L221P	probably damaging	Het
Rcn2	C	T	9: 56,057,561	Q268*	probably null	Het
Reps1	T	A	10: 18,093,855	D235E	probably damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,911		probably benign	Het
Sap30bp	A	G	11: 115,933,488		probably benign	Het
Scn1a	A	T	2: 66,287,731	S1433T	probably damaging	Het
Sde2	T	C	1: 180,851,189	V6A	probably benign	Het
Sdk1	C	A	5: 142,212,014	R2141S	probably benign	Het
Setd2	T	C	9: 110,550,572	S1152P	probably damaging	Het
Slc26a2	C	T	18: 61,201,854	V176I	probably damaging	Het
Snx7	A	G	3: 117,846,632	I76T	possibly damaging	Het
Specc1l	C	A	10: 75,246,279	A520D	probably benign	Het
Spop	A	G	11: 95,471,310	T56A	possibly damaging	Het
Syne2	T	A	12: 76,028,012	D4576E	probably damaging	Het
Tas2r134	A	C	2: 51,627,589	M27L	probably benign	Het
Tecta	A	C	9: 42,366,786	I1142S	probably benign	Het
Timm44	T	C	8: 4,266,611	D311G	possibly damaging	Het
Tmem123	C	G	9: 7,791,070	T124R	possibly damaging	Het
Tmem184b	A	T	15: 79,362,759	L370Q	probably benign	Het
Trim25	T	A	11: 88,999,503	N5K	probably benign	Het
Vmn2r93	A	G	17: 18,304,641	Y187C	probably damaging	Het
Vpreb1	A	G	16: 16,868,814	Y71H	probably damaging	Het
Vpreb2	T	C	16: 17,980,577	S5P	probably benign	Het
Xpo7	A	T	14: 70,669,448	C939S	probably benign	Het
Zfp78	C	A	7: 6,378,765	S271R	probably benign	Het
Zic5	A	T	14: 122,464,668	M217K	probably benign	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
Brimming	UTSW	9	18592680	missense	probably damaging	0.99
R7038_muc16_859	UTSW	9	18620468	missense	probably damaging	0.99
Runneymeade	UTSW	9	18579317	critical splice donor site	probably null
slimey	UTSW	9	18590698	missense	probably damaging	1.00
viscous	UTSW	9	18644732	missense	unknown
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	splice site	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	splice site	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7744:Muc16	UTSW	9	18585096	critical splice acceptor site	probably null
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7805:Muc16	UTSW	9	18638493	missense	possibly damaging	0.94
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83
R7845:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7849:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7884:Muc16	UTSW	9	18642694	missense	unknown
R7885:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7886:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7899:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7904:Muc16	UTSW	9	18655650	missense	unknown
R7921:Muc16	UTSW	9	18659318	missense	unknown
R7922:Muc16	UTSW	9	18584825	missense	probably benign	0.16
R7948:Muc16	UTSW	9	18642490	missense	unknown
R7957:Muc16	UTSW	9	18643471	missense	unknown
R7972:Muc16	UTSW	9	18645764	nonsense	probably null
R7992:Muc16	UTSW	9	18656429	missense	unknown
R7998:Muc16	UTSW	9	18639892	missense	probably benign	0.04
R8014:Muc16	UTSW	9	18654875	missense	unknown
R8033:Muc16	UTSW	9	18636606	missense	probably benign	0.26
R8052:Muc16	UTSW	9	18659051	missense	unknown
R8058:Muc16	UTSW	9	18660002	nonsense	probably null
R8088:Muc16	UTSW	9	18519300	nonsense	probably null
R8095:Muc16	UTSW	9	18584830	nonsense	probably null
R8111:Muc16	UTSW	9	18592629	missense	possibly damaging	0.55
R8116:Muc16	UTSW	9	18658737	missense	unknown
R8117:Muc16	UTSW	9	18508910	nonsense	probably null
R8137:Muc16	UTSW	9	18645676	missense	unknown
R8196:Muc16	UTSW	9	18645334	missense	unknown
R8218:Muc16	UTSW	9	18637019	missense	possibly damaging	0.48
R8285:Muc16	UTSW	9	18642977	missense	unknown
R8313:Muc16	UTSW	9	18525147	missense	possibly damaging	0.85
R8317:Muc16	UTSW	9	18658043	missense	unknown
R8342:Muc16	UTSW	9	18658685	missense	unknown
R8351:Muc16	UTSW	9	18659885	missense	unknown
R8356:Muc16	UTSW	9	18658778	missense	unknown
R8360:Muc16	UTSW	9	18525258	missense	probably benign	0.01
R8418:Muc16	UTSW	9	18519630	missense	possibly damaging	0.94
R8420:Muc16	UTSW	9	18537511	missense	probably damaging	0.99
R8437:Muc16	UTSW	9	18657924	missense	unknown
R8463:Muc16	UTSW	9	18659139	missense	unknown
R8466:Muc16	UTSW	9	18643148	missense	unknown
R8512:Muc16	UTSW	9	18638192	missense	probably benign	0.01
R8518:Muc16	UTSW	9	18519631	missense	probably benign	0.12
R8556:Muc16	UTSW	9	18640937	missense	probably benign	0.01
R8679:Muc16	UTSW	9	18646448	missense	unknown
R8680:Muc16	UTSW	9	18644719	missense	unknown
R8720:Muc16	UTSW	9	18641600	missense	probably benign	0.01
R8729:Muc16	UTSW	9	18660050	missense	unknown
R8736:Muc16	UTSW	9	18550843	nonsense	probably null
R8739:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R8807:Muc16	UTSW	9	18656057	missense	unknown
R8830:Muc16	UTSW	9	18646069	missense	unknown
R8871:Muc16	UTSW	9	18656048	missense	unknown
R8884:Muc16	UTSW	9	18644200	missense	unknown
R8923:Muc16	UTSW	9	18638676	missense	probably benign	0.01
R8948:Muc16	UTSW	9	18647233	missense	unknown
R8949:Muc16	UTSW	9	18520925	critical splice donor site	probably null
R8987:Muc16	UTSW	9	18551685	nonsense	probably null
R8997:Muc16	UTSW	9	18607467	intron	probably benign
R9013:Muc16	UTSW	9	18512773	missense	possibly damaging	0.94
R9020:Muc16	UTSW	9	18638719	small insertion	probably benign
R9036:Muc16	UTSW	9	18644679	missense	unknown
R9040:Muc16	UTSW	9	18644786	nonsense	probably null
R9065:Muc16	UTSW	9	18643009	missense	unknown
R9089:Muc16	UTSW	9	18644550	missense	unknown
R9098:Muc16	UTSW	9	18643679	missense	unknown
R9100:Muc16	UTSW	9	18645670	missense	unknown
R9128:Muc16	UTSW	9	18647582	missense	unknown
R9169:Muc16	UTSW	9	18656528	missense	unknown
R9180:Muc16	UTSW	9	18642742	missense	unknown
R9191:Muc16	UTSW	9	18644810	missense	unknown
R9203:Muc16	UTSW	9	18551688	missense	unknown
R9208:Muc16	UTSW	9	18508537	missense	probably damaging	0.99
R9232:Muc16	UTSW	9	18656040	missense	unknown
R9240:Muc16	UTSW	9	18538013	missense	unknown
R9254:Muc16	UTSW	9	18646171	missense	unknown
R9330:Muc16	UTSW	9	18641036	missense	probably benign	0.04
R9347:Muc16	UTSW	9	18660215	missense	unknown
R9358:Muc16	UTSW	9	18642224	missense	probably benign	0.01
R9359:Muc16	UTSW	9	18537764	critical splice donor site	probably null
R9379:Muc16	UTSW	9	18646171	missense	unknown
R9403:Muc16	UTSW	9	18537764	critical splice donor site	probably null
R9422:Muc16	UTSW	9	18641806	missense	probably benign	0.01
R9433:Muc16	UTSW	9	18572641	missense	probably benign	0.09
R9438:Muc16	UTSW	9	18647732	missense	unknown
R9442:Muc16	UTSW	9	18655328	missense	unknown
R9453:Muc16	UTSW	9	18660765	missense	unknown
R9467:Muc16	UTSW	9	18597035	missense	probably benign	0.03
R9490:Muc16	UTSW	9	18656853	nonsense	probably null
R9519:Muc16	UTSW	9	18586920	missense	probably benign	0.03
R9524:Muc16	UTSW	9	18586018	missense	probably benign	0.03
R9556:Muc16	UTSW	9	18658638	missense	unknown
R9583:Muc16	UTSW	9	18638677	missense	probably benign	0.01
R9600:Muc16	UTSW	9	18655851	missense	unknown
R9638:Muc16	UTSW	9	18639330	missense	probably benign	0.12
R9650:Muc16	UTSW	9	18642466	missense	unknown
R9652:Muc16	UTSW	9	18586882	missense	probably benign	0.03
R9666:Muc16	UTSW	9	18655989	missense	unknown
R9682:Muc16	UTSW	9	18642578	missense	unknown
R9765:Muc16	UTSW	9	18637198	missense	probably benign	0.16
R9766:Muc16	UTSW	9	18636857	missense	probably benign	0.08
R9766:Muc16	UTSW	9	18641087	missense	probably benign	0.01
R9776:Muc16	UTSW	9	18659379	missense	unknown
R9782:Muc16	UTSW	9	18636770	missense	possibly damaging	0.64
Z1177:Muc16	UTSW	9	18537571	missense	probably benign	0.26
Z1177:Muc16	UTSW	9	18657861	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGTGAGATCATCATTTGTTGAACAC -3'
(R):5'- GCAAAGAAAGCCAGTCGGTC -3'

Sequencing Primer
(F):5'- CATCATTTGTTGAACACTAGTTGAAG -3'
(R):5'- AGTCGGTCATTACAACTCTAGCTG -3'

Posted On

2019-05-13