Incidental Mutation 'R6996:Myo5c'
ID544216
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
Synonyms9130003O20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6996 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75250464 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 233 (I233T)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555] [ENSMUST00000216788]
Predicted Effect probably benign
Transcript: ENSMUST00000036555
AA Change: I233T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: I233T

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216788
AA Change: I233T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 G A 8: 24,806,501 S310L probably damaging Het
Adamts16 C T 13: 70,798,038 probably null Het
Arrb1 C A 7: 99,591,362 D194E probably benign Het
Atp1a3 T C 7: 24,997,626 D217G probably damaging Het
Bcar3 A G 3: 122,508,384 I123V possibly damaging Het
Bdp1 G A 13: 100,043,813 L1833F probably damaging Het
Cdc14a T C 3: 116,328,706 Y155C probably damaging Het
Cdo1 C A 18: 46,720,313 R126M possibly damaging Het
Cfap99 G T 5: 34,327,260 R627L probably damaging Het
Efr3a T A 15: 65,848,181 L369* probably null Het
Erich6 A C 3: 58,636,095 F185V probably damaging Het
Fam186a T C 15: 99,955,493 D122G unknown Het
Fank1 A G 7: 133,876,898 I230M possibly damaging Het
Flg2 A T 3: 93,202,670 E668D unknown Het
Flg2 A C 3: 93,202,949 R761S unknown Het
Gabrr1 T C 4: 33,158,157 L260P probably damaging Het
Gfm2 G A 13: 97,149,360 R119K probably damaging Het
Gm14226 A G 2: 155,024,437 T105A probably benign Het
Gm14496 A G 2: 181,996,204 N357S probably damaging Het
Gm5916 G A 9: 36,128,639 L18F probably benign Het
Gm884 A T 11: 103,618,757 L795* probably null Het
Golm1 A T 13: 59,642,244 N247K probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Greb1 C T 12: 16,723,354 A240T probably benign Het
Gtf3c6 T C 10: 40,249,778 M148V probably benign Het
Guca1a T C 17: 47,395,177 S126G probably benign Het
Hacl1 A T 14: 31,615,423 I393N possibly damaging Het
Hddc3 A G 7: 80,343,750 D68G possibly damaging Het
Hsfy2 T C 1: 56,636,410 T323A possibly damaging Het
Kcng2 T C 18: 80,323,143 probably benign Het
Kdm2a G T 19: 4,345,641 P321T probably benign Het
Krt31 A G 11: 100,047,732 V345A probably benign Het
Mettl1 T C 10: 127,045,018 S193P probably benign Het
Mme G A 3: 63,346,102 D456N possibly damaging Het
Mmrn1 A G 6: 60,977,383 T883A probably benign Het
Mphosph10 C G 7: 64,388,921 E293Q probably benign Het
Muc16 C A 9: 18,645,897 K3033N unknown Het
Myo16 C T 8: 10,569,496 T1349M probably damaging Het
Olfr1356 C A 10: 78,847,517 V133L probably benign Het
Olfr1465 A T 19: 13,313,672 S204R probably benign Het
Olfr190 A G 16: 59,074,192 M296T probably benign Het
Olfr475-ps1 A G 2: 88,623,845 T181A unknown Het
Olfr622 T G 7: 103,639,858 N94T probably benign Het
Olfr655 A T 7: 104,596,811 F123L probably benign Het
Olfr791 T A 10: 129,526,863 V212E probably damaging Het
Oxct2b A G 4: 123,117,687 I467V probably benign Het
Parp1 A T 1: 180,587,371 N425Y possibly damaging Het
Pcdhgc3 T A 18: 37,806,603 V19D possibly damaging Het
Pfkl T A 10: 77,997,589 I260F probably damaging Het
Pkd1l1 C T 11: 8,849,046 G1789R probably damaging Het
Pla1a G A 16: 38,397,468 A386V probably benign Het
Pml A G 9: 58,234,886 L221P probably damaging Het
Rcn2 C T 9: 56,057,561 Q268* probably null Het
Reps1 T A 10: 18,093,855 D235E probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sap30bp A G 11: 115,933,488 probably benign Het
Scn1a A T 2: 66,287,731 S1433T probably damaging Het
Sde2 T C 1: 180,851,189 V6A probably benign Het
Sdk1 C A 5: 142,212,014 R2141S probably benign Het
Setd2 T C 9: 110,550,572 S1152P probably damaging Het
Slc26a2 C T 18: 61,201,854 V176I probably damaging Het
Snx7 A G 3: 117,846,632 I76T possibly damaging Het
Specc1l C A 10: 75,246,279 A520D probably benign Het
Spop A G 11: 95,471,310 T56A possibly damaging Het
Syne2 T A 12: 76,028,012 D4576E probably damaging Het
Tas2r134 A C 2: 51,627,589 M27L probably benign Het
Tecta A C 9: 42,366,786 I1142S probably benign Het
Timm44 T C 8: 4,266,611 D311G possibly damaging Het
Tmem123 C G 9: 7,791,070 T124R possibly damaging Het
Tmem184b A T 15: 79,362,759 L370Q probably benign Het
Trim25 T A 11: 88,999,503 N5K probably benign Het
Vmn2r93 A G 17: 18,304,641 Y187C probably damaging Het
Vpreb1 A G 16: 16,868,814 Y71H probably damaging Het
Vpreb2 T C 16: 17,980,577 S5P probably benign Het
Xpo7 A T 14: 70,669,448 C939S probably benign Het
Zfp78 C A 7: 6,378,765 S271R probably benign Het
Zic5 A T 14: 122,464,668 M217K probably benign Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
PIT4431001:Myo5c UTSW 9 75252571 missense possibly damaging 0.75
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
R7023:Myo5c UTSW 9 75301456 missense probably damaging 0.98
R7123:Myo5c UTSW 9 75289223 missense probably benign
R7250:Myo5c UTSW 9 75262215 missense probably damaging 1.00
R7316:Myo5c UTSW 9 75269638 missense probably benign 0.00
R7340:Myo5c UTSW 9 75289141 missense probably benign
R7382:Myo5c UTSW 9 75304050 missense probably damaging 1.00
R7426:Myo5c UTSW 9 75251527 splice site probably null
R7788:Myo5c UTSW 9 75279345 missense probably damaging 0.98
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Z1177:Myo5c UTSW 9 75246255 missense not run
Predicted Primers PCR Primer
(F):5'- AGAACCAGGCTGCTCTTCTC -3'
(R):5'- CCAGGAGTCTGAGTATTTGGAGC -3'

Sequencing Primer
(F):5'- GCTCTTCTCCAGCTCCAAG -3'
(R):5'- TTCTCTTCAGGCACACTAGAAGAGG -3'
Posted On2019-05-13