Incidental Mutation 'R6996:Olfr791'
ID 544224
Institutional Source Beutler Lab
Gene Symbol Olfr791
Ensembl Gene ENSMUSG00000047626
Gene Name olfactory receptor 791
Synonyms GA_x6K02T2PULF-11205096-11206034, MOR114-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock # R6996 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 129521792-129528353 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 129526863 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 212 (V212E)
Ref Sequence ENSEMBL: ENSMUSP00000150497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057477] [ENSMUST00000217228]
AlphaFold Q8VGJ0
Predicted Effect probably damaging
Transcript: ENSMUST00000057477
AA Change: V212E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052722
Gene: ENSMUSG00000047626
AA Change: V212E

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 7.6e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4.3e-6 PFAM
Pfam:7tm_1 39 288 4.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217228
AA Change: V212E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 G A 8: 24,806,501 S310L probably damaging Het
Adamts16 C T 13: 70,798,038 probably null Het
Arrb1 C A 7: 99,591,362 D194E probably benign Het
Atp1a3 T C 7: 24,997,626 D217G probably damaging Het
Bcar3 A G 3: 122,508,384 I123V possibly damaging Het
Bdp1 G A 13: 100,043,813 L1833F probably damaging Het
Cdc14a T C 3: 116,328,706 Y155C probably damaging Het
Cdo1 C A 18: 46,720,313 R126M possibly damaging Het
Cfap99 G T 5: 34,327,260 R627L probably damaging Het
Efr3a T A 15: 65,848,181 L369* probably null Het
Erich6 A C 3: 58,636,095 F185V probably damaging Het
Fam186a T C 15: 99,955,493 D122G unknown Het
Fank1 A G 7: 133,876,898 I230M possibly damaging Het
Flg2 A T 3: 93,202,670 E668D unknown Het
Flg2 A C 3: 93,202,949 R761S unknown Het
Gabrr1 T C 4: 33,158,157 L260P probably damaging Het
Gfm2 G A 13: 97,149,360 R119K probably damaging Het
Gm14226 A G 2: 155,024,437 T105A probably benign Het
Gm14496 A G 2: 181,996,204 N357S probably damaging Het
Gm5916 G A 9: 36,128,639 L18F probably benign Het
Gm884 A T 11: 103,618,757 L795* probably null Het
Golm1 A T 13: 59,642,244 N247K probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Greb1 C T 12: 16,723,354 A240T probably benign Het
Gtf3c6 T C 10: 40,249,778 M148V probably benign Het
Guca1a T C 17: 47,395,177 S126G probably benign Het
Hacl1 A T 14: 31,615,423 I393N possibly damaging Het
Hddc3 A G 7: 80,343,750 D68G possibly damaging Het
Hsfy2 T C 1: 56,636,410 T323A possibly damaging Het
Kcng2 T C 18: 80,323,143 probably benign Het
Kdm2a G T 19: 4,345,641 P321T probably benign Het
Krt31 A G 11: 100,047,732 V345A probably benign Het
Mettl1 T C 10: 127,045,018 S193P probably benign Het
Mme G A 3: 63,346,102 D456N possibly damaging Het
Mmrn1 A G 6: 60,977,383 T883A probably benign Het
Mphosph10 C G 7: 64,388,921 E293Q probably benign Het
Muc16 C A 9: 18,645,897 K3033N unknown Het
Myo16 C T 8: 10,569,496 T1349M probably damaging Het
Myo5c T C 9: 75,250,464 I233T probably benign Het
Olfr1356 C A 10: 78,847,517 V133L probably benign Het
Olfr1465 A T 19: 13,313,672 S204R probably benign Het
Olfr190 A G 16: 59,074,192 M296T probably benign Het
Olfr475-ps1 A G 2: 88,623,845 T181A unknown Het
Olfr622 T G 7: 103,639,858 N94T probably benign Het
Olfr655 A T 7: 104,596,811 F123L probably benign Het
Oxct2b A G 4: 123,117,687 I467V probably benign Het
Parp1 A T 1: 180,587,371 N425Y possibly damaging Het
Pcdhgc3 T A 18: 37,806,603 V19D possibly damaging Het
Pfkl T A 10: 77,997,589 I260F probably damaging Het
Pkd1l1 C T 11: 8,849,046 G1789R probably damaging Het
Pla1a G A 16: 38,397,468 A386V probably benign Het
Pml A G 9: 58,234,886 L221P probably damaging Het
Rcn2 C T 9: 56,057,561 Q268* probably null Het
Reps1 T A 10: 18,093,855 D235E probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sap30bp A G 11: 115,933,488 probably benign Het
Scn1a A T 2: 66,287,731 S1433T probably damaging Het
Sde2 T C 1: 180,851,189 V6A probably benign Het
Sdk1 C A 5: 142,212,014 R2141S probably benign Het
Setd2 T C 9: 110,550,572 S1152P probably damaging Het
Slc26a2 C T 18: 61,201,854 V176I probably damaging Het
Snx7 A G 3: 117,846,632 I76T possibly damaging Het
Specc1l C A 10: 75,246,279 A520D probably benign Het
Spop A G 11: 95,471,310 T56A possibly damaging Het
Syne2 T A 12: 76,028,012 D4576E probably damaging Het
Tas2r134 A C 2: 51,627,589 M27L probably benign Het
Tecta A C 9: 42,366,786 I1142S probably benign Het
Timm44 T C 8: 4,266,611 D311G possibly damaging Het
Tmem123 C G 9: 7,791,070 T124R possibly damaging Het
Tmem184b A T 15: 79,362,759 L370Q probably benign Het
Trim25 T A 11: 88,999,503 N5K probably benign Het
Vmn2r93 A G 17: 18,304,641 Y187C probably damaging Het
Vpreb1 A G 16: 16,868,814 Y71H probably damaging Het
Vpreb2 T C 16: 17,980,577 S5P probably benign Het
Xpo7 A T 14: 70,669,448 C939S probably benign Het
Zfp78 C A 7: 6,378,765 S271R probably benign Het
Zic5 A T 14: 122,464,668 M217K probably benign Het
Other mutations in Olfr791
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Olfr791 APN 10 129526995 missense probably damaging 0.97
IGL03034:Olfr791 APN 10 129526658 missense probably benign
IGL03281:Olfr791 APN 10 129526403 missense probably benign 0.31
R0555:Olfr791 UTSW 10 129526896 missense possibly damaging 0.90
R1474:Olfr791 UTSW 10 129526955 missense probably benign 0.03
R1638:Olfr791 UTSW 10 129526619 missense probably benign 0.00
R1917:Olfr791 UTSW 10 129527049 missense probably damaging 0.99
R1918:Olfr791 UTSW 10 129527049 missense probably damaging 0.99
R1919:Olfr791 UTSW 10 129527049 missense probably damaging 0.99
R2303:Olfr791 UTSW 10 129527049 missense probably benign 0.10
R3113:Olfr791 UTSW 10 129527143 missense probably benign 0.08
R3929:Olfr791 UTSW 10 129526231 start codon destroyed probably null 1.00
R4704:Olfr791 UTSW 10 129526302 missense possibly damaging 0.90
R4831:Olfr791 UTSW 10 129526580 missense probably damaging 1.00
R5207:Olfr791 UTSW 10 129526904 missense probably benign 0.08
R5313:Olfr791 UTSW 10 129527081 missense probably damaging 1.00
R5644:Olfr791 UTSW 10 129527103 missense probably damaging 1.00
R5661:Olfr791 UTSW 10 129526749 missense probably benign 0.45
R5894:Olfr791 UTSW 10 129526488 missense probably damaging 0.98
R6988:Olfr791 UTSW 10 129526673 missense probably benign 0.02
R7380:Olfr791 UTSW 10 129526661 missense probably benign
R7539:Olfr791 UTSW 10 129527105 nonsense probably null
R7552:Olfr791 UTSW 10 129526560 missense possibly damaging 0.95
R7635:Olfr791 UTSW 10 129526682 missense probably benign 0.00
R8084:Olfr791 UTSW 10 129526940 missense probably damaging 1.00
R8260:Olfr791 UTSW 10 129527088 missense possibly damaging 0.55
R8755:Olfr791 UTSW 10 129526463 missense possibly damaging 0.60
X0066:Olfr791 UTSW 10 129526745 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCATCTGTAAACCCCTTC -3'
(R):5'- ATGGCCACTTCATCCTTAGC -3'

Sequencing Primer
(F):5'- GTGTCTGGCCTAATGATTATCAC -3'
(R):5'- ACTTCATCCTTAGCCGATGG -3'
Posted On 2019-05-13