Incidental Mutation 'R6996:Gm884'
ID544229
Institutional Source Beutler Lab
Gene Symbol Gm884
Ensembl Gene ENSMUSG00000034239
Gene Namepredicted gene 884
SynonymsLOC380730
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R6996 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location103534577-103621140 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 103618757 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 795 (L795*)
Ref Sequence ENSEMBL: ENSMUSP00000058511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059279] [ENSMUST00000167262]
Predicted Effect probably null
Transcript: ENSMUST00000059279
AA Change: L795*
SMART Domains Protein: ENSMUSP00000058511
Gene: ENSMUSG00000034239
AA Change: L795*

DomainStartEndE-ValueType
Pfam:LRRC37 149 223 5.4e-10 PFAM
low complexity region 244 264 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
Pfam:LRRC37 335 403 1.9e-14 PFAM
Pfam:LRRC37 419 514 1.2e-8 PFAM
Pfam:LRRC37 565 620 2e-10 PFAM
Pfam:LRRC37 669 739 7.6e-18 PFAM
Pfam:LRRC37 741 792 1.6e-9 PFAM
Pfam:LRRC37 789 860 1.4e-23 PFAM
Pfam:LRRC37 861 914 2.8e-9 PFAM
Pfam:LRRC37 911 983 1.9e-23 PFAM
Pfam:LRRC37 979 1038 1e-8 PFAM
Pfam:LRRC37 1034 1105 2.7e-24 PFAM
Pfam:LRRC37 1105 1158 2.3e-9 PFAM
Pfam:LRRC37 1155 1219 2.4e-17 PFAM
Pfam:LRRC37 1222 1265 9.2e-7 PFAM
Pfam:LRRC37 1263 1330 4.9e-24 PFAM
Pfam:LRRC37 1331 1384 1.4e-10 PFAM
Pfam:LRRC37 1380 1451 4.3e-15 PFAM
Pfam:LRRC37 1487 1558 1.9e-15 PFAM
Pfam:LRRC37 1594 1665 2.9e-18 PFAM
Pfam:LRRC37 1701 1772 5.6e-23 PFAM
Pfam:LRRC37 1808 1910 2.8e-18 PFAM
Pfam:LRRC37 1915 1986 7.2e-17 PFAM
Pfam:LRRC37 2022 2093 4.9e-22 PFAM
Pfam:LRRC37 2129 2200 4.4e-22 PFAM
Pfam:LRRC37 2236 2307 2.1e-21 PFAM
Pfam:LRRC37 2343 2414 3.8e-17 PFAM
Pfam:LRRC37 2449 2519 1.6e-19 PFAM
LRR 2777 2796 3.09e1 SMART
LRR_TYP 2797 2820 2.09e-3 SMART
LRR 2821 2844 4.44e0 SMART
LRR 2848 2872 8.26e1 SMART
low complexity region 2991 3002 N/A INTRINSIC
low complexity region 3220 3230 N/A INTRINSIC
low complexity region 3382 3393 N/A INTRINSIC
Pfam:LRRC37AB_C 3424 3570 7.7e-76 PFAM
low complexity region 3571 3589 N/A INTRINSIC
low complexity region 3622 3640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167262
SMART Domains Protein: ENSMUSP00000129662
Gene: ENSMUSG00000034239

DomainStartEndE-ValueType
internal_repeat_1 1 70 1.46e-11 PROSPERO
internal_repeat_1 108 290 1.46e-11 PROSPERO
LRR 601 620 3.09e1 SMART
LRR_TYP 621 644 2.09e-3 SMART
LRR 645 668 4.44e0 SMART
LRR 672 696 8.26e1 SMART
low complexity region 815 826 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Pfam:LRRC37AB_C 1243 1396 1.2e-92 PFAM
low complexity region 1446 1464 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 G A 8: 24,806,501 S310L probably damaging Het
Adamts16 C T 13: 70,798,038 probably null Het
Arrb1 C A 7: 99,591,362 D194E probably benign Het
Atp1a3 T C 7: 24,997,626 D217G probably damaging Het
Bcar3 A G 3: 122,508,384 I123V possibly damaging Het
Bdp1 G A 13: 100,043,813 L1833F probably damaging Het
Cdc14a T C 3: 116,328,706 Y155C probably damaging Het
Cdo1 C A 18: 46,720,313 R126M possibly damaging Het
Cfap99 G T 5: 34,327,260 R627L probably damaging Het
Efr3a T A 15: 65,848,181 L369* probably null Het
Erich6 A C 3: 58,636,095 F185V probably damaging Het
Fam186a T C 15: 99,955,493 D122G unknown Het
Fank1 A G 7: 133,876,898 I230M possibly damaging Het
Flg2 A T 3: 93,202,670 E668D unknown Het
Flg2 A C 3: 93,202,949 R761S unknown Het
Gabrr1 T C 4: 33,158,157 L260P probably damaging Het
Gfm2 G A 13: 97,149,360 R119K probably damaging Het
Gm14226 A G 2: 155,024,437 T105A probably benign Het
Gm14496 A G 2: 181,996,204 N357S probably damaging Het
Gm5916 G A 9: 36,128,639 L18F probably benign Het
Golm1 A T 13: 59,642,244 N247K probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Greb1 C T 12: 16,723,354 A240T probably benign Het
Gtf3c6 T C 10: 40,249,778 M148V probably benign Het
Guca1a T C 17: 47,395,177 S126G probably benign Het
Hacl1 A T 14: 31,615,423 I393N possibly damaging Het
Hddc3 A G 7: 80,343,750 D68G possibly damaging Het
Hsfy2 T C 1: 56,636,410 T323A possibly damaging Het
Kcng2 T C 18: 80,323,143 probably benign Het
Kdm2a G T 19: 4,345,641 P321T probably benign Het
Krt31 A G 11: 100,047,732 V345A probably benign Het
Mettl1 T C 10: 127,045,018 S193P probably benign Het
Mme G A 3: 63,346,102 D456N possibly damaging Het
Mmrn1 A G 6: 60,977,383 T883A probably benign Het
Mphosph10 C G 7: 64,388,921 E293Q probably benign Het
Muc16 C A 9: 18,645,897 K3033N unknown Het
Myo16 C T 8: 10,569,496 T1349M probably damaging Het
Myo5c T C 9: 75,250,464 I233T probably benign Het
Olfr1356 C A 10: 78,847,517 V133L probably benign Het
Olfr1465 A T 19: 13,313,672 S204R probably benign Het
Olfr190 A G 16: 59,074,192 M296T probably benign Het
Olfr475-ps1 A G 2: 88,623,845 T181A unknown Het
Olfr622 T G 7: 103,639,858 N94T probably benign Het
Olfr655 A T 7: 104,596,811 F123L probably benign Het
Olfr791 T A 10: 129,526,863 V212E probably damaging Het
Oxct2b A G 4: 123,117,687 I467V probably benign Het
Parp1 A T 1: 180,587,371 N425Y possibly damaging Het
Pcdhgc3 T A 18: 37,806,603 V19D possibly damaging Het
Pfkl T A 10: 77,997,589 I260F probably damaging Het
Pkd1l1 C T 11: 8,849,046 G1789R probably damaging Het
Pla1a G A 16: 38,397,468 A386V probably benign Het
Pml A G 9: 58,234,886 L221P probably damaging Het
Rcn2 C T 9: 56,057,561 Q268* probably null Het
Reps1 T A 10: 18,093,855 D235E probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sap30bp A G 11: 115,933,488 probably benign Het
Scn1a A T 2: 66,287,731 S1433T probably damaging Het
Sde2 T C 1: 180,851,189 V6A probably benign Het
Sdk1 C A 5: 142,212,014 R2141S probably benign Het
Setd2 T C 9: 110,550,572 S1152P probably damaging Het
Slc26a2 C T 18: 61,201,854 V176I probably damaging Het
Snx7 A G 3: 117,846,632 I76T possibly damaging Het
Specc1l C A 10: 75,246,279 A520D probably benign Het
Spop A G 11: 95,471,310 T56A possibly damaging Het
Syne2 T A 12: 76,028,012 D4576E probably damaging Het
Tas2r134 A C 2: 51,627,589 M27L probably benign Het
Tecta A C 9: 42,366,786 I1142S probably benign Het
Timm44 T C 8: 4,266,611 D311G possibly damaging Het
Tmem123 C G 9: 7,791,070 T124R possibly damaging Het
Tmem184b A T 15: 79,362,759 L370Q probably benign Het
Trim25 T A 11: 88,999,503 N5K probably benign Het
Vmn2r93 A G 17: 18,304,641 Y187C probably damaging Het
Vpreb1 A G 16: 16,868,814 Y71H probably damaging Het
Vpreb2 T C 16: 17,980,577 S5P probably benign Het
Xpo7 A T 14: 70,669,448 C939S probably benign Het
Zfp78 C A 7: 6,378,765 S271R probably benign Het
Zic5 A T 14: 122,464,668 M217K probably benign Het
Other mutations in Gm884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Gm884 APN 11 103615410 missense probably benign 0.01
IGL00576:Gm884 APN 11 103617386 unclassified probably benign
IGL00813:Gm884 APN 11 103614498 missense probably benign 0.05
IGL01311:Gm884 APN 11 103534676 missense unknown
IGL01946:Gm884 APN 11 103612933 missense probably benign 0.28
IGL02217:Gm884 APN 11 103612871 splice site probably benign
IGL02556:Gm884 APN 11 103613283 missense probably benign 0.01
IGL02825:Gm884 APN 11 103617068 unclassified probably benign
IGL02868:Gm884 APN 11 103615139 missense probably benign 0.10
IGL02904:Gm884 APN 11 103616361 unclassified probably benign
IGL03008:Gm884 APN 11 103620467 missense unknown
IGL03120:Gm884 APN 11 103616975 unclassified probably benign
IGL03159:Gm884 APN 11 103604502 splice site probably benign
IGL03181:Gm884 APN 11 103616416 unclassified probably benign
IGL03202:Gm884 APN 11 103615373 missense probably benign 0.03
IGL03263:Gm884 APN 11 103613699 missense possibly damaging 0.86
PIT4486001:Gm884 UTSW 11 103618201 missense unknown
R0040:Gm884 UTSW 11 103542990 missense probably damaging 0.99
R0135:Gm884 UTSW 11 103618047 unclassified probably benign
R0141:Gm884 UTSW 11 103613686 missense probably damaging 1.00
R0226:Gm884 UTSW 11 103603241 missense probably benign 0.08
R0547:Gm884 UTSW 11 103620164 missense unknown
R0646:Gm884 UTSW 11 103613160 nonsense probably null
R0685:Gm884 UTSW 11 103616888 unclassified probably benign
R0732:Gm884 UTSW 11 103619838 missense unknown
R1015:Gm884 UTSW 11 103545796 missense probably benign 0.01
R1166:Gm884 UTSW 11 103615383 missense probably benign 0.21
R1168:Gm884 UTSW 11 103618950 unclassified probably benign
R1257:Gm884 UTSW 11 103534641 missense unknown
R1545:Gm884 UTSW 11 103608919 missense probably benign 0.16
R1570:Gm884 UTSW 11 103609938 missense possibly damaging 0.76
R1677:Gm884 UTSW 11 103614942 missense probably benign 0.19
R1703:Gm884 UTSW 11 103540874 missense probably benign 0.39
R1719:Gm884 UTSW 11 103617071 unclassified probably benign
R1752:Gm884 UTSW 11 103614555 missense possibly damaging 0.67
R1870:Gm884 UTSW 11 103620605 missense unknown
R2155:Gm884 UTSW 11 103620459 missense unknown
R2191:Gm884 UTSW 11 103618967 unclassified probably benign
R2271:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R2378:Gm884 UTSW 11 103619711 unclassified probably benign
R2405:Gm884 UTSW 11 103620984 missense unknown
R2864:Gm884 UTSW 11 103540918 missense probably benign 0.34
R3011:Gm884 UTSW 11 103613103 missense possibly damaging 0.62
R3415:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3417:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3835:Gm884 UTSW 11 103620010 missense unknown
R3974:Gm884 UTSW 11 103619101 unclassified probably benign
R4019:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4020:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4176:Gm884 UTSW 11 103536600 missense unknown
R4361:Gm884 UTSW 11 103617501 frame shift probably null
R4418:Gm884 UTSW 11 103618314 unclassified probably benign
R4633:Gm884 UTSW 11 103619131 unclassified probably benign
R4693:Gm884 UTSW 11 103619860 missense unknown
R4758:Gm884 UTSW 11 103614464 missense possibly damaging 0.48
R4878:Gm884 UTSW 11 103617891 unclassified probably benign
R4887:Gm884 UTSW 11 103614872 missense probably benign 0.03
R4944:Gm884 UTSW 11 103613460 missense possibly damaging 0.68
R4952:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R5030:Gm884 UTSW 11 103534849 missense unknown
R5183:Gm884 UTSW 11 103543121 missense probably damaging 0.99
R5294:Gm884 UTSW 11 103616231 unclassified probably benign
R5317:Gm884 UTSW 11 103614145 missense possibly damaging 0.73
R5334:Gm884 UTSW 11 103613873 missense probably benign 0.18
R5426:Gm884 UTSW 11 103620760 missense unknown
R5467:Gm884 UTSW 11 103603265 nonsense probably null
R5518:Gm884 UTSW 11 103615253 missense probably benign 0.03
R5634:Gm884 UTSW 11 103542014 missense possibly damaging 0.95
R5647:Gm884 UTSW 11 103617474 unclassified probably benign
R5663:Gm884 UTSW 11 103613123 missense probably benign 0.01
R5668:Gm884 UTSW 11 103617054 unclassified probably benign
R5763:Gm884 UTSW 11 103613643 missense probably damaging 0.97
R5829:Gm884 UTSW 11 103541886 missense possibly damaging 0.95
R5871:Gm884 UTSW 11 103616454 unclassified probably benign
R5905:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R5940:Gm884 UTSW 11 103613886 missense probably benign 0.18
R5964:Gm884 UTSW 11 103542120 missense possibly damaging 0.92
R5988:Gm884 UTSW 11 103615896 unclassified probably benign
R5992:Gm884 UTSW 11 103613792 missense possibly damaging 0.81
R6114:Gm884 UTSW 11 103617791 unclassified probably benign
R6154:Gm884 UTSW 11 103614143 missense probably benign 0.33
R6233:Gm884 UTSW 11 103613388 missense probably damaging 0.98
R6301:Gm884 UTSW 11 103618930 unclassified probably benign
R6362:Gm884 UTSW 11 103620652 missense unknown
R6471:Gm884 UTSW 11 103619622 unclassified probably benign
R6806:Gm884 UTSW 11 103621124 missense unknown
R6962:Gm884 UTSW 11 103614300 missense possibly damaging 0.67
R7028:Gm884 UTSW 11 103614537 missense probably benign 0.28
R7034:Gm884 UTSW 11 103615812 unclassified probably benign
R7036:Gm884 UTSW 11 103615812 unclassified probably benign
R7113:Gm884 UTSW 11 103618799 missense unknown
R7405:Gm884 UTSW 11 103615161 missense probably benign 0.02
R7420:Gm884 UTSW 11 103613625 missense probably benign 0.11
R7461:Gm884 UTSW 11 103616290 missense unknown
R7544:Gm884 UTSW 11 103615448 missense probably benign 0.01
R7613:Gm884 UTSW 11 103616290 missense unknown
R7711:Gm884 UTSW 11 103614912 missense probably benign 0.02
R7714:Gm884 UTSW 11 103616893 missense unknown
R7747:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R7814:Gm884 UTSW 11 103614173 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TCCATTAGCCTCTGGAGTTATGG -3'
(R):5'- TTGGACCTGGAAGTCACTGTAAC -3'

Sequencing Primer
(F):5'- ATGGTGGGTTCCAGATCTAAGG -3'
(R):5'- CTCCAGAGACTATGCATATGTTACC -3'
Posted On2019-05-13