Mutagenetix > Incidental Mutation

Incidental Mutation 'R6996:Bdp1'

544237

Institutional Source

Beutler Lab

Gene Symbol

Bdp1

Ensembl Gene

ENSMUSG00000049658

Gene Name

B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB

Synonyms

TAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6996 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

100017994-100104070 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 100043813 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 1833 (L1833F)

Ref Sequence

ENSEMBL: ENSMUSP00000105005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]

AlphaFold

Q571C7

Predicted Effect

probably damaging
Transcript: ENSMUST00000038104
AA Change: L1833F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: L1833F

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	375	399	N/A	INTRINSIC
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	3.56e-18	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	3.56e-18	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099262

Predicted Effect

probably damaging
Transcript: ENSMUST00000109379
AA Change: L1833F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: L1833F

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	4.79e-19	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	4.79e-19	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam5	G	A	8: 24,806,501	S310L	probably damaging	Het
Adamts16	C	T	13: 70,798,038		probably null	Het
Arrb1	C	A	7: 99,591,362	D194E	probably benign	Het
Atp1a3	T	C	7: 24,997,626	D217G	probably damaging	Het
Bcar3	A	G	3: 122,508,384	I123V	possibly damaging	Het
Cdc14a	T	C	3: 116,328,706	Y155C	probably damaging	Het
Cdo1	C	A	18: 46,720,313	R126M	possibly damaging	Het
Cfap99	G	T	5: 34,327,260	R627L	probably damaging	Het
Efr3a	T	A	15: 65,848,181	L369*	probably null	Het
Erich6	A	C	3: 58,636,095	F185V	probably damaging	Het
Fam186a	T	C	15: 99,955,493	D122G	unknown	Het
Fank1	A	G	7: 133,876,898	I230M	possibly damaging	Het
Flg2	A	T	3: 93,202,670	E668D	unknown	Het
Flg2	A	C	3: 93,202,949	R761S	unknown	Het
Gabrr1	T	C	4: 33,158,157	L260P	probably damaging	Het
Gfm2	G	A	13: 97,149,360	R119K	probably damaging	Het
Gm14226	A	G	2: 155,024,437	T105A	probably benign	Het
Gm14496	A	G	2: 181,996,204	N357S	probably damaging	Het
Gm5916	G	A	9: 36,128,639	L18F	probably benign	Het
Gm884	A	T	11: 103,618,757	L795*	probably null	Het
Golm1	A	T	13: 59,642,244	N247K	probably benign	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Greb1	C	T	12: 16,723,354	A240T	probably benign	Het
Gtf3c6	T	C	10: 40,249,778	M148V	probably benign	Het
Guca1a	T	C	17: 47,395,177	S126G	probably benign	Het
Hacl1	A	T	14: 31,615,423	I393N	possibly damaging	Het
Hddc3	A	G	7: 80,343,750	D68G	possibly damaging	Het
Hsfy2	T	C	1: 56,636,410	T323A	possibly damaging	Het
Kcng2	T	C	18: 80,323,143		probably benign	Het
Kdm2a	G	T	19: 4,345,641	P321T	probably benign	Het
Krt31	A	G	11: 100,047,732	V345A	probably benign	Het
Mettl1	T	C	10: 127,045,018	S193P	probably benign	Het
Mme	G	A	3: 63,346,102	D456N	possibly damaging	Het
Mmrn1	A	G	6: 60,977,383	T883A	probably benign	Het
Mphosph10	C	G	7: 64,388,921	E293Q	probably benign	Het
Muc16	C	A	9: 18,645,897	K3033N	unknown	Het
Myo16	C	T	8: 10,569,496	T1349M	probably damaging	Het
Myo5c	T	C	9: 75,250,464	I233T	probably benign	Het
Olfr1356	C	A	10: 78,847,517	V133L	probably benign	Het
Olfr1465	A	T	19: 13,313,672	S204R	probably benign	Het
Olfr190	A	G	16: 59,074,192	M296T	probably benign	Het
Olfr475-ps1	A	G	2: 88,623,845	T181A	unknown	Het
Olfr622	T	G	7: 103,639,858	N94T	probably benign	Het
Olfr655	A	T	7: 104,596,811	F123L	probably benign	Het
Olfr791	T	A	10: 129,526,863	V212E	probably damaging	Het
Oxct2b	A	G	4: 123,117,687	I467V	probably benign	Het
Parp1	A	T	1: 180,587,371	N425Y	possibly damaging	Het
Pcdhgc3	T	A	18: 37,806,603	V19D	possibly damaging	Het
Pfkl	T	A	10: 77,997,589	I260F	probably damaging	Het
Pkd1l1	C	T	11: 8,849,046	G1789R	probably damaging	Het
Pla1a	G	A	16: 38,397,468	A386V	probably benign	Het
Pml	A	G	9: 58,234,886	L221P	probably damaging	Het
Rcn2	C	T	9: 56,057,561	Q268*	probably null	Het
Reps1	T	A	10: 18,093,855	D235E	probably damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,911		probably benign	Het
Sap30bp	A	G	11: 115,933,488		probably benign	Het
Scn1a	A	T	2: 66,287,731	S1433T	probably damaging	Het
Sde2	T	C	1: 180,851,189	V6A	probably benign	Het
Sdk1	C	A	5: 142,212,014	R2141S	probably benign	Het
Setd2	T	C	9: 110,550,572	S1152P	probably damaging	Het
Slc26a2	C	T	18: 61,201,854	V176I	probably damaging	Het
Snx7	A	G	3: 117,846,632	I76T	possibly damaging	Het
Specc1l	C	A	10: 75,246,279	A520D	probably benign	Het
Spop	A	G	11: 95,471,310	T56A	possibly damaging	Het
Syne2	T	A	12: 76,028,012	D4576E	probably damaging	Het
Tas2r134	A	C	2: 51,627,589	M27L	probably benign	Het
Tecta	A	C	9: 42,366,786	I1142S	probably benign	Het
Timm44	T	C	8: 4,266,611	D311G	possibly damaging	Het
Tmem123	C	G	9: 7,791,070	T124R	possibly damaging	Het
Tmem184b	A	T	15: 79,362,759	L370Q	probably benign	Het
Trim25	T	A	11: 88,999,503	N5K	probably benign	Het
Vmn2r93	A	G	17: 18,304,641	Y187C	probably damaging	Het
Vpreb1	A	G	16: 16,868,814	Y71H	probably damaging	Het
Vpreb2	T	C	16: 17,980,577	S5P	probably benign	Het
Xpo7	A	T	14: 70,669,448	C939S	probably benign	Het
Zfp78	C	A	7: 6,378,765	S271R	probably benign	Het
Zic5	A	T	14: 122,464,668	M217K	probably benign	Het

Other mutations in Bdp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Bdp1	APN	13	100098510	missense	probably damaging	1.00
IGL00096:Bdp1	APN	13	100060865	missense	possibly damaging	0.61
IGL00160:Bdp1	APN	13	100061198	missense	probably benign	0.00
IGL00924:Bdp1	APN	13	100097579	missense	possibly damaging	0.89
IGL01337:Bdp1	APN	13	100056192	missense	probably benign	0.00
IGL01344:Bdp1	APN	13	100078080	missense	probably benign	0.06
IGL01347:Bdp1	APN	13	100070203	missense	possibly damaging	0.79
IGL01620:Bdp1	APN	13	100084205	splice site	probably benign
IGL01871:Bdp1	APN	13	100066053	missense	probably benign	0.01
IGL02008:Bdp1	APN	13	100023827	missense	possibly damaging	0.92
IGL02112:Bdp1	APN	13	100037800	missense	probably benign	0.02
IGL02214:Bdp1	APN	13	100041535	missense	probably benign	0.00
IGL02236:Bdp1	APN	13	100060891	missense	probably benign
IGL02307:Bdp1	APN	13	100093438	missense	probably damaging	1.00
IGL02364:Bdp1	APN	13	100055308	splice site	probably benign
IGL02415:Bdp1	APN	13	100089408	missense	probably damaging	0.96
IGL02601:Bdp1	APN	13	100098514	missense	possibly damaging	0.72
IGL02605:Bdp1	APN	13	100078115	critical splice acceptor site	probably null
IGL02664:Bdp1	APN	13	100051539	missense	probably benign	0.29
IGL02738:Bdp1	APN	13	100051353	missense	probably benign	0.26
IGL02754:Bdp1	APN	13	100060973	missense	possibly damaging	0.94
IGL02967:Bdp1	APN	13	100042270	missense	possibly damaging	0.92
IGL02974:Bdp1	APN	13	100055292	missense	probably benign	0.00
IGL03156:Bdp1	APN	13	100061036	missense	probably benign	0.44
IGL03166:Bdp1	APN	13	100035800	missense	probably benign	0.28
IGL03232:Bdp1	APN	13	100051481	missense	probably damaging	1.00
D3080:Bdp1	UTSW	13	100023621	missense	probably benign	0.02
R0115:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0481:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0619:Bdp1	UTSW	13	100037858	missense	probably benign	0.00
R0730:Bdp1	UTSW	13	100058951	splice site	probably benign
R0744:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R0833:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R1307:Bdp1	UTSW	13	100049763	missense	possibly damaging	0.89
R1325:Bdp1	UTSW	13	100099008	missense	probably damaging	0.97
R1346:Bdp1	UTSW	13	100078755	nonsense	probably null
R1644:Bdp1	UTSW	13	100060940	missense	probably benign	0.03
R1670:Bdp1	UTSW	13	100027433	critical splice donor site	probably null
R1836:Bdp1	UTSW	13	100035145	missense	probably benign
R1869:Bdp1	UTSW	13	100042201	missense	probably damaging	0.99
R1920:Bdp1	UTSW	13	100098589	missense	probably benign	0.30
R1944:Bdp1	UTSW	13	100074381	splice site	probably null
R2030:Bdp1	UTSW	13	100061189	missense	probably benign	0.00
R2069:Bdp1	UTSW	13	100050988	missense	probably benign	0.00
R2180:Bdp1	UTSW	13	100061405	small insertion	probably benign
R2263:Bdp1	UTSW	13	100066037	missense	probably damaging	0.96
R2277:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2277:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2278:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2278:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2336:Bdp1	UTSW	13	100053002	missense	probably damaging	0.99
R2380:Bdp1	UTSW	13	100060370	missense	probably benign	0.08
R3154:Bdp1	UTSW	13	100049814	missense	probably damaging	1.00
R4212:Bdp1	UTSW	13	100059585	missense	probably benign
R4322:Bdp1	UTSW	13	100092223	missense	probably damaging	0.97
R4414:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4415:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4764:Bdp1	UTSW	13	100056267	missense	probably damaging	0.99
R4766:Bdp1	UTSW	13	100049868	missense	probably damaging	0.96
R4888:Bdp1	UTSW	13	100051119	missense	probably benign	0.26
R4914:Bdp1	UTSW	13	100056336	missense	probably benign	0.28
R4917:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R4918:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R5170:Bdp1	UTSW	13	100030794	nonsense	probably null
R5266:Bdp1	UTSW	13	100067535	missense	probably benign	0.33
R5312:Bdp1	UTSW	13	100097601	splice site	probably null
R5420:Bdp1	UTSW	13	100066043	missense	possibly damaging	0.88
R5486:Bdp1	UTSW	13	100098510	missense	probably damaging	1.00
R5909:Bdp1	UTSW	13	100092286	missense	probably benign	0.08
R5913:Bdp1	UTSW	13	100051104	missense	probably benign	0.41
R6018:Bdp1	UTSW	13	100038224	missense	probably benign	0.00
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6700:Bdp1	UTSW	13	100025528	missense	probably benign	0.00
R6969:Bdp1	UTSW	13	100074531	missense	probably damaging	0.97
R6972:Bdp1	UTSW	13	100037761	missense	probably null	1.00
R7043:Bdp1	UTSW	13	100078707	missense	probably benign	0.03
R7060:Bdp1	UTSW	13	100059494	missense	probably damaging	1.00
R7105:Bdp1	UTSW	13	100070181	missense	probably damaging	1.00
R7155:Bdp1	UTSW	13	100061151	missense	possibly damaging	0.93
R7175:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7177:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7327:Bdp1	UTSW	13	100041532	missense	probably damaging	0.97
R7512:Bdp1	UTSW	13	100050949	missense	probably benign	0.03
R7562:Bdp1	UTSW	13	100025541	missense	probably benign	0.04
R7583:Bdp1	UTSW	13	100049812	missense	probably damaging	1.00
R7788:Bdp1	UTSW	13	100055251	missense	possibly damaging	0.64
R7842:Bdp1	UTSW	13	100099129	missense	probably damaging	1.00
R7850:Bdp1	UTSW	13	100092324	missense	probably damaging	1.00
R7904:Bdp1	UTSW	13	100041436	missense	probably benign	0.37
R7975:Bdp1	UTSW	13	100020376	missense	probably benign	0.01
R7999:Bdp1	UTSW	13	100058896	missense	possibly damaging	0.93
R8126:Bdp1	UTSW	13	100056282	missense	probably damaging	1.00
R8340:Bdp1	UTSW	13	100065968	missense	possibly damaging	0.61
R8414:Bdp1	UTSW	13	100064477	missense	probably benign	0.03
R8468:Bdp1	UTSW	13	100060568	missense	probably benign	0.04
R8688:Bdp1	UTSW	13	100103799	missense	probably damaging	1.00
R8871:Bdp1	UTSW	13	100049667	missense	probably damaging	1.00
R8976:Bdp1	UTSW	13	100060899	nonsense	probably null
R8987:Bdp1	UTSW	13	100067513	missense	probably benign	0.01
R9157:Bdp1	UTSW	13	100049928	missense	probably benign	0.40
R9437:Bdp1	UTSW	13	100025650	missense	probably benign	0.31
R9612:Bdp1	UTSW	13	100077862	missense	probably benign	0.18
R9679:Bdp1	UTSW	13	100043777	missense	probably damaging	0.98
RF003:Bdp1	UTSW	13	100060449	missense	probably benign	0.31
RF003:Bdp1	UTSW	13	100060450	missense	probably benign	0.31
Z1177:Bdp1	UTSW	13	100061396	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCACTGCATCTGAAGAGACTAAG -3'
(R):5'- ACATGACGTGTGATGGGAGC -3'

Sequencing Primer
(F):5'- CTGCATCTGAAGAGACTAAGTAAAAC -3'
(R):5'- CAGACTGTGGCTGAGGACTG -3'

Posted On

2019-05-13