Incidental Mutation 'R6996:Pla1a'
ID544246
Institutional Source Beutler Lab
Gene Symbol Pla1a
Ensembl Gene ENSMUSG00000002847
Gene Namephospholipase A1 member A
SynonymsPs-pla1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6996 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location38396117-38433145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38397468 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 386 (A386V)
Ref Sequence ENSEMBL: ENSMUSP00000002926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002926]
Predicted Effect probably benign
Transcript: ENSMUST00000002926
AA Change: A386V

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000002926
Gene: ENSMUSG00000002847
AA Change: A386V

DomainStartEndE-ValueType
Pfam:Lipase 15 336 9.4e-111 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phospholipase that hydrolyzes fatty acids at the sn-1 position of phosphatidylserine and 1-acyl-2-lysophosphatidylserine. This secreted protein hydrolyzes phosphatidylserine in liposomes. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 G A 8: 24,806,501 S310L probably damaging Het
Adamts16 C T 13: 70,798,038 probably null Het
Arrb1 C A 7: 99,591,362 D194E probably benign Het
Atp1a3 T C 7: 24,997,626 D217G probably damaging Het
Bcar3 A G 3: 122,508,384 I123V possibly damaging Het
Bdp1 G A 13: 100,043,813 L1833F probably damaging Het
Cdc14a T C 3: 116,328,706 Y155C probably damaging Het
Cdo1 C A 18: 46,720,313 R126M possibly damaging Het
Cfap99 G T 5: 34,327,260 R627L probably damaging Het
Efr3a T A 15: 65,848,181 L369* probably null Het
Erich6 A C 3: 58,636,095 F185V probably damaging Het
Fam186a T C 15: 99,955,493 D122G unknown Het
Fank1 A G 7: 133,876,898 I230M possibly damaging Het
Flg2 A T 3: 93,202,670 E668D unknown Het
Flg2 A C 3: 93,202,949 R761S unknown Het
Gabrr1 T C 4: 33,158,157 L260P probably damaging Het
Gfm2 G A 13: 97,149,360 R119K probably damaging Het
Gm14226 A G 2: 155,024,437 T105A probably benign Het
Gm14496 A G 2: 181,996,204 N357S probably damaging Het
Gm5916 G A 9: 36,128,639 L18F probably benign Het
Gm884 A T 11: 103,618,757 L795* probably null Het
Golm1 A T 13: 59,642,244 N247K probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Greb1 C T 12: 16,723,354 A240T probably benign Het
Gtf3c6 T C 10: 40,249,778 M148V probably benign Het
Guca1a T C 17: 47,395,177 S126G probably benign Het
Hacl1 A T 14: 31,615,423 I393N possibly damaging Het
Hddc3 A G 7: 80,343,750 D68G possibly damaging Het
Hsfy2 T C 1: 56,636,410 T323A possibly damaging Het
Kcng2 T C 18: 80,323,143 probably benign Het
Kdm2a G T 19: 4,345,641 P321T probably benign Het
Krt31 A G 11: 100,047,732 V345A probably benign Het
Mettl1 T C 10: 127,045,018 S193P probably benign Het
Mme G A 3: 63,346,102 D456N possibly damaging Het
Mmrn1 A G 6: 60,977,383 T883A probably benign Het
Mphosph10 C G 7: 64,388,921 E293Q probably benign Het
Muc16 C A 9: 18,645,897 K3033N unknown Het
Myo16 C T 8: 10,569,496 T1349M probably damaging Het
Myo5c T C 9: 75,250,464 I233T probably benign Het
Olfr1356 C A 10: 78,847,517 V133L probably benign Het
Olfr1465 A T 19: 13,313,672 S204R probably benign Het
Olfr190 A G 16: 59,074,192 M296T probably benign Het
Olfr475-ps1 A G 2: 88,623,845 T181A unknown Het
Olfr622 T G 7: 103,639,858 N94T probably benign Het
Olfr655 A T 7: 104,596,811 F123L probably benign Het
Olfr791 T A 10: 129,526,863 V212E probably damaging Het
Oxct2b A G 4: 123,117,687 I467V probably benign Het
Parp1 A T 1: 180,587,371 N425Y possibly damaging Het
Pcdhgc3 T A 18: 37,806,603 V19D possibly damaging Het
Pfkl T A 10: 77,997,589 I260F probably damaging Het
Pkd1l1 C T 11: 8,849,046 G1789R probably damaging Het
Pml A G 9: 58,234,886 L221P probably damaging Het
Rcn2 C T 9: 56,057,561 Q268* probably null Het
Reps1 T A 10: 18,093,855 D235E probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sap30bp A G 11: 115,933,488 probably benign Het
Scn1a A T 2: 66,287,731 S1433T probably damaging Het
Sde2 T C 1: 180,851,189 V6A probably benign Het
Sdk1 C A 5: 142,212,014 R2141S probably benign Het
Setd2 T C 9: 110,550,572 S1152P probably damaging Het
Slc26a2 C T 18: 61,201,854 V176I probably damaging Het
Snx7 A G 3: 117,846,632 I76T possibly damaging Het
Specc1l C A 10: 75,246,279 A520D probably benign Het
Spop A G 11: 95,471,310 T56A possibly damaging Het
Syne2 T A 12: 76,028,012 D4576E probably damaging Het
Tas2r134 A C 2: 51,627,589 M27L probably benign Het
Tecta A C 9: 42,366,786 I1142S probably benign Het
Timm44 T C 8: 4,266,611 D311G possibly damaging Het
Tmem123 C G 9: 7,791,070 T124R possibly damaging Het
Tmem184b A T 15: 79,362,759 L370Q probably benign Het
Trim25 T A 11: 88,999,503 N5K probably benign Het
Vmn2r93 A G 17: 18,304,641 Y187C probably damaging Het
Vpreb1 A G 16: 16,868,814 Y71H probably damaging Het
Vpreb2 T C 16: 17,980,577 S5P probably benign Het
Xpo7 A T 14: 70,669,448 C939S probably benign Het
Zfp78 C A 7: 6,378,765 S271R probably benign Het
Zic5 A T 14: 122,464,668 M217K probably benign Het
Other mutations in Pla1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Pla1a APN 16 38414850 missense probably damaging 1.00
IGL01086:Pla1a APN 16 38407622 missense probably benign 0.02
IGL01126:Pla1a APN 16 38407639 missense probably benign
R1674:Pla1a UTSW 16 38414810 missense probably benign 0.00
R2101:Pla1a UTSW 16 38415368 missense probably damaging 0.99
R2415:Pla1a UTSW 16 38407750 missense possibly damaging 0.69
R2987:Pla1a UTSW 16 38407742 missense probably damaging 1.00
R4492:Pla1a UTSW 16 38409610 missense probably benign
R5365:Pla1a UTSW 16 38417207 missense probably benign 0.01
R5424:Pla1a UTSW 16 38414775 missense probably damaging 1.00
R6349:Pla1a UTSW 16 38417124 missense probably benign 0.04
R6388:Pla1a UTSW 16 38397472 missense probably benign
R6443:Pla1a UTSW 16 38409587 splice site probably null
R7021:Pla1a UTSW 16 38400882 missense probably damaging 0.97
R7519:Pla1a UTSW 16 38414846 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATCCAGAGCTGTGCTTGGTG -3'
(R):5'- AAAACTGTTGGCCTGTGCG -3'

Sequencing Primer
(F):5'- GGTGTTGCAGGGGTGCTTAG -3'
(R):5'- GAGGATTCAAAAACGCTGCGTCTC -3'
Posted On2019-05-13